ID: 1018789246

View in Genome Browser
Species Human (GRCh38)
Location 6:167133671-167133693
Sequence TTGTATCTACAGATCGATTT GGG
Strand +
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 1583
Summary {0: 1, 1: 0, 2: 19, 3: 260, 4: 1303}

Found 3 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1018789244_1018789246 0 Left 1018789244 6:167133648-167133670 CCATAATTTTGATTTAGTTTATG 0: 1
1: 0
2: 3
3: 38
4: 634
Right 1018789246 6:167133671-167133693 TTGTATCTACAGATCGATTTGGG 0: 1
1: 0
2: 19
3: 260
4: 1303
1018789242_1018789246 5 Left 1018789242 6:167133643-167133665 CCCTACCATAATTTTGATTTAGT 0: 1
1: 0
2: 1
3: 27
4: 238
Right 1018789246 6:167133671-167133693 TTGTATCTACAGATCGATTTGGG 0: 1
1: 0
2: 19
3: 260
4: 1303
1018789243_1018789246 4 Left 1018789243 6:167133644-167133666 CCTACCATAATTTTGATTTAGTT 0: 1
1: 0
2: 2
3: 44
4: 425
Right 1018789246 6:167133671-167133693 TTGTATCTACAGATCGATTTGGG 0: 1
1: 0
2: 19
3: 260
4: 1303

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1018789246 Original CRISPR TTGTATCTACAGATCGATTT GGG Intronic
900296322 1:1952984-1953006 TTGAATCTATAGATCAATTTGGG - Intronic
900811906 1:4809818-4809840 TTGAATCTATAGATCAAGTTGGG - Intergenic
901172665 1:7272322-7272344 TTGAATCTGTAGATCAATTTGGG - Intronic
901189640 1:7401561-7401583 TTGAATCTATAGATCAGTTTGGG + Intronic
901266768 1:7916825-7916847 TTAAATCTACAGGTCAATTTAGG - Exonic
901313455 1:8288394-8288416 TTGAATCTGTAGATCAATTTGGG + Intergenic
903074680 1:20754413-20754435 TTGAACCTATAGATCAATTTGGG - Intronic
903150959 1:21408418-21408440 TTGAATCTATAGATCAATTTGGG + Intergenic
903584708 1:24403526-24403548 TTGAATCTATAGAACAATTTAGG + Intronic
904338603 1:29814898-29814920 TTGAATCTATTGATCAATTTGGG + Intergenic
904537758 1:31211555-31211577 TTGAATCTGTAGATCAATTTGGG - Intronic
904776274 1:32909031-32909053 TTGAATCTGTAGATCAATTTGGG - Intergenic
904802859 1:33107900-33107922 TTGAATCTATGGATCGCTTTGGG - Intronic
904958823 1:34314033-34314055 TTGAATCTATAGATCAAATTGGG + Intergenic
905032401 1:34895580-34895602 TTGCATATACACATGGATTTTGG - Intronic
905143337 1:35866816-35866838 TTAGATCTACAAATCAATTTGGG - Intergenic
905288080 1:36898607-36898629 TTGAATCTACAGATCACTTTGGG - Intronic
905288310 1:36902155-36902177 CTGTATCTATAAATCAATTTGGG - Intronic
905558102 1:38903650-38903672 TTGAATCTATAGATCAACTTGGG - Intronic
905593048 1:39181410-39181432 TTGAATCTATAGATCAGTTTGGG - Intronic
905713795 1:40130771-40130793 TTGAATCTGCAGATCAATTTGGG + Intergenic
905767787 1:40616581-40616603 TTGTATCTAGGGATCAATTTGGG + Intergenic
905963893 1:42072231-42072253 TTGAATCTATAGATCAAATTGGG + Intergenic
905966356 1:42100642-42100664 TTGAATCTGTAGATCAATTTGGG - Intergenic
905982260 1:42240286-42240308 TTGAATCTATACATTGATTTGGG - Intronic
906015396 1:42573212-42573234 TTGAATCTATAGGTCAATTTGGG + Intronic
906029819 1:42709636-42709658 TTGAATCTATAGATTGTTTTGGG + Intergenic
906111519 1:43326266-43326288 TTGAATCTATAGACCAATTTGGG - Intergenic
906216022 1:44040070-44040092 ATGTATGTACACATCTATTTTGG + Intergenic
906368735 1:45234257-45234279 TTGAATCTACAGATAAATTTGGG - Intronic
906598140 1:47098185-47098207 TTGAATCTATAAATCGCTTTGGG + Intronic
906742429 1:48195898-48195920 TTGTTTGTACAGATCCATTTCGG - Intergenic
906951609 1:50339054-50339076 TTGAATCTATAGATCAAGTTAGG + Intergenic
907154312 1:52319273-52319295 TTGAAGCTACAGATCAATTTGGG - Intronic
907567941 1:55454581-55454603 TTGTATCTGTAGATCAATTTGGG - Intergenic
908866281 1:68552301-68552323 TTGAATCTATAGATTGCTTTGGG - Intergenic
909183530 1:72455208-72455230 TTGAATCTATAGATTGCTTTGGG - Intergenic
909230040 1:73076724-73076746 TTGAATCTAAAGAACAATTTGGG - Intergenic
909248590 1:73322971-73322993 TTGAATCTGTAGATCTATTTGGG + Intergenic
909267612 1:73580756-73580778 TTGAATCTGCAGATTGCTTTGGG - Intergenic
909424463 1:75506415-75506437 TTGAATCTATAGATTGCTTTGGG + Intronic
909589567 1:77330778-77330800 TTTAATCTACAGATCAATTTGGG + Intronic
909661405 1:78087165-78087187 TTGAATCTGCAAATTGATTTAGG - Intronic
909823035 1:80090067-80090089 TTGAATCTACAGATTACTTTGGG + Intergenic
909887013 1:80954525-80954547 CTGAATCTACAGATCAATTTGGG - Intergenic
909922196 1:81396075-81396097 TTGAATCTATAGATCACTTTTGG + Intronic
910025839 1:82650529-82650551 TTGAATCTGTAGATCAATTTGGG - Intergenic
910220217 1:84882412-84882434 TTGAATCTATAGATTGCTTTGGG - Intronic
910222758 1:84904893-84904915 TTGATTCTACAGATTGAATTGGG - Intergenic
910546849 1:88427903-88427925 TTGAATCTATAGATTGCTTTGGG - Intergenic
910589432 1:88913842-88913864 TTGAATCTGTAGATCGCTTTGGG + Intergenic
910686573 1:89923506-89923528 CTGTATCTACATATTGCTTTGGG - Intronic
910705098 1:90120856-90120878 TTGAATCTATAGATTGCTTTAGG + Intergenic
910827102 1:91420842-91420864 TTGAGTCAACAGATTGATTTGGG + Intergenic
910932255 1:92454337-92454359 TTGAATCTATAAATCAATTTGGG + Intergenic
910993967 1:93084557-93084579 TTGAATCTATAGATTGATTTGGG + Intronic
911250068 1:95565559-95565581 TTGAATCTATAGATCAATTTGGG + Intergenic
911471201 1:98320340-98320362 TTGAAGCTATAGATCGAGTTGGG - Intergenic
911934752 1:103955101-103955123 TTGAATCTAGAGATTGAGTTGGG + Intergenic
911970218 1:104425399-104425421 TTGAATCTATAGATAAATTTTGG - Intergenic
911975932 1:104494816-104494838 TTGTATCTGTAGATTGCTTTGGG - Intergenic
911977473 1:104517920-104517942 TTGAATCTATAGATTGCTTTGGG - Intergenic
911992512 1:104719609-104719631 TTGAATCTATACATCAATTTGGG - Intergenic
912028680 1:105211324-105211346 TTGAATCTATAGATTGCTTTGGG - Intergenic
912041159 1:105392411-105392433 TTGAATCTTTAGATTGATTTGGG + Intergenic
912049338 1:105505202-105505224 TTGAATCTGCAGATTGCTTTAGG - Intergenic
912054928 1:105583060-105583082 TTGATTCTACAGATTGCTTTGGG + Intergenic
912064135 1:105714374-105714396 TTGAATCTGCAGATCAGTTTTGG + Intergenic
912275197 1:108249887-108249909 TTGCATCTGGAGATCAATTTGGG + Intergenic
912293025 1:108444462-108444484 TTGCATCTGGAGATCAATTTGGG - Intronic
912479357 1:109968320-109968342 TTGAATCTACAGATTGAGTTGGG - Intergenic
912601543 1:110939409-110939431 TTGAATCTATAGATTGCTTTAGG - Intergenic
912604759 1:110978394-110978416 TTGAATCTATAGATTGCTTTTGG + Intergenic
912608438 1:111017617-111017639 TTGAATCTATAGATTGCTTTGGG + Intergenic
912767149 1:112424584-112424606 TTGAATCTAGAGATCAATTTGGG + Intronic
912898837 1:113625272-113625294 TTGAATCTATAGATTGGTTTGGG + Intronic
914234718 1:145798729-145798751 TTGAATCTGTAGATCGCTTTGGG + Intronic
914792726 1:150892942-150892964 TTGTATCCATAGATCAATCTGGG + Intergenic
915085193 1:153382707-153382729 TTGAATCTATAGATTGCTTTGGG - Intergenic
915388250 1:155517024-155517046 TTGAATCTACAGATCACTTTAGG - Intronic
915423913 1:155807871-155807893 TTGAATCTGTAGATCAATTTGGG + Intronic
915858398 1:159415637-159415659 TTGGATCTATAGATCACTTTGGG + Intergenic
915871728 1:159567802-159567824 TTAAATCTACAGATCAAGTTGGG - Intergenic
916371112 1:164095293-164095315 TTGGATCTATAGATTGCTTTAGG - Intergenic
916468321 1:165094441-165094463 TTGTATCTACAGCACCATTTTGG - Intergenic
916559591 1:165922250-165922272 TTGAATCCATAGATCAATTTGGG + Intergenic
916709010 1:167385260-167385282 TTGAATCTAGAGGTCAATTTGGG - Intronic
917001084 1:170360526-170360548 TTGAATCTACAGATTAATTTAGG - Intergenic
917008332 1:170441407-170441429 TTGAATCTATAGATCAATTTGGG - Intergenic
917400748 1:174646778-174646800 TTGAATCTAAAGATTGCTTTGGG + Intronic
917446694 1:175111564-175111586 TTGAATCTATAGATTGCTTTTGG + Intronic
917551660 1:176038318-176038340 TTCAATCTATAGATCAATTTGGG - Intronic
917757196 1:178113750-178113772 TTAAATCTATAGATCAATTTTGG + Intronic
918090041 1:181282700-181282722 TTGAATCTACAGATCAAGTTGGG + Intergenic
918274127 1:182935245-182935267 CTGGATCTACAGATCAAGTTGGG + Intronic
918532120 1:185535041-185535063 GTGAATCTACAGATCATTTTGGG + Intergenic
918665658 1:187147259-187147281 TTGAATCTATAGATCAAGTTGGG + Intergenic
918982542 1:191581977-191581999 TTGAATCTACAAATTGCTTTGGG + Intergenic
919170164 1:193943817-193943839 TTGAATCTATAGATTGCTTTGGG - Intergenic
919269555 1:195321794-195321816 TTGAATCTATAGATTGCTTTAGG + Intergenic
919431047 1:197492081-197492103 TTGAATCTGCAGATTGCTTTAGG - Intergenic
919721173 1:200837640-200837662 TTGAATCTATACATTGATTTGGG + Intronic
920168286 1:204052126-204052148 TTGAATCTATATATCAATTTTGG + Intergenic
920889541 1:209970631-209970653 TTGAATTTACAGATTGCTTTGGG + Intronic
920985013 1:210880162-210880184 TTAAATCTACAGATCAATTTGGG - Intronic
921013400 1:211164269-211164291 TTGAATCTACAAATCGCTTTGGG + Intergenic
921093289 1:211863545-211863567 TTGAATCTACAGATCAAGTTGGG + Intergenic
921107589 1:211997922-211997944 TTACATCTAAAGATCAATTTGGG - Intronic
921689624 1:218133064-218133086 TTGGACCTACAGGTCAATTTGGG - Intergenic
921843236 1:219851386-219851408 CTGAATCTGCAGATCGCTTTAGG - Intronic
921961366 1:221038263-221038285 TTGAATCTATAAATCGCTTTGGG + Intergenic
921975452 1:221197975-221197997 TTGAATCTATACATTGATTTGGG - Intergenic
921994408 1:221402171-221402193 TTGAATCTGCAGATTGCTTTGGG - Intergenic
922254521 1:223881893-223881915 TTGAATATACAGATCAATTTTGG - Intergenic
922640794 1:227229573-227229595 CTGTATCTGTAGATCAATTTGGG + Intronic
923059840 1:230461338-230461360 TTGAATCTATAGATCAAGTTAGG - Intergenic
923619071 1:235562721-235562743 TTGAATCTACAGATCAAGTTGGG + Intronic
924125349 1:240844598-240844620 CTGTATCTACAAATCTATTCAGG + Intronic
924260856 1:242229523-242229545 TTGGATCTATAGATCAATTTGGG + Intronic
924871735 1:248054508-248054530 TTGTATCTATAAATTGCTTTGGG + Intronic
1062859651 10:801145-801167 TTGAATCTATAGATTGCTTTGGG - Intergenic
1063188856 10:3674896-3674918 TTAAATCTATAGATCAATTTTGG - Intergenic
1063732259 10:8711187-8711209 TTGAATCTCCAGATCAATTTGGG + Intergenic
1064524328 10:16237868-16237890 TTGAATCTATGGATCCATTTGGG - Intergenic
1064607210 10:17055842-17055864 TTGAATTTACAGACCAATTTGGG - Intronic
1065156846 10:22878843-22878865 TTGAATCTATAGATTGCTTTGGG + Intergenic
1065192825 10:23229897-23229919 TTAAATCTACAGTTCAATTTAGG - Intronic
1065365531 10:24932708-24932730 TTGAATCTATAGATCAATTTGGG - Intronic
1065607549 10:27435006-27435028 ATAAATCTACAGATCAATTTGGG - Intergenic
1065609208 10:27454466-27454488 TTGTATCTGTAGATTGCTTTGGG + Intergenic
1065615643 10:27519747-27519769 TTGAATCTATAGATCACTTTGGG - Intronic
1065954441 10:30680723-30680745 TTGAATTTATAGATCGAGTTGGG + Intergenic
1066135588 10:32442468-32442490 TTGGATTTATAGATCAATTTGGG + Intergenic
1066251778 10:33640166-33640188 TTGCATCTATAGAACAATTTGGG + Intergenic
1066519659 10:36201809-36201831 CTGAATCTACAGATCAAGTTGGG + Intergenic
1066589191 10:36974829-36974851 TTGAATCTGTAGATTGATTTGGG - Intergenic
1066621738 10:37361953-37361975 TTGTGTCTGCAGATTGCTTTGGG + Intronic
1067516929 10:46956799-46956821 TTGAATCTGTAGATCGTTTTGGG + Intronic
1067645323 10:48095027-48095049 TTGAATCTGTAGATCGTTTTGGG - Intergenic
1067898148 10:50208735-50208757 TTGAATTTACAGATTAATTTGGG - Intronic
1068023360 10:51612206-51612228 TTGAATCTGCAGATTGCTTTGGG + Intronic
1068190109 10:53640488-53640510 TTCTATCTATAGATCAATTTGGG - Intergenic
1068221252 10:54048936-54048958 TTGCATCTACAGATTGCTGTGGG + Intronic
1068373642 10:56151475-56151497 TTGGATCTACAGATTGCTTTAGG - Intergenic
1068453750 10:57228533-57228555 TTGAATCTATAGATCTTTTTGGG + Intergenic
1068497343 10:57800100-57800122 TTGAATCTATAGATCAATTCAGG + Intergenic
1068824829 10:61424482-61424504 TTGAATCTAAAGATCAATTTGGG - Intronic
1068961902 10:62875249-62875271 TTGAATCTGCAGATTGCTTTGGG + Intronic
1068979655 10:63048792-63048814 TTCAATCTGCAGATCAATTTGGG - Intergenic
1069022891 10:63508547-63508569 TTGAATCTATAGATCAAGTTGGG + Intergenic
1069044581 10:63729251-63729273 TTGAATCTGCAGATTGCTTTGGG - Intergenic
1069068287 10:63968825-63968847 TTGAATCTGCAGATTGCTTTGGG - Intergenic
1069157125 10:65043750-65043772 TTGAATCTATAGATTGCTTTGGG + Intergenic
1069194799 10:65537772-65537794 TTGAATCTACAAATTGCTTTGGG - Intergenic
1069284898 10:66701419-66701441 TTAAATCTACAGATCAATTGAGG + Intronic
1069378053 10:67813920-67813942 TTGAATCTGCAGATCAGTTTGGG - Intronic
1069468633 10:68665340-68665362 TTGAATCTAGAGATCAATTTTGG + Intronic
1069647679 10:70015689-70015711 TTGAATCTATAGATCACTTTGGG - Intergenic
1069778072 10:70938304-70938326 CTGGATCCTCAGATCGATTTGGG - Intergenic
1070072902 10:73106952-73106974 TTGAATCTGTAGATCAATTTGGG + Intergenic
1070317198 10:75325683-75325705 ATGAATCTACAGATCAATTTGGG + Intergenic
1070375085 10:75822388-75822410 TTGAATCTATAGATTGCTTTGGG - Intronic
1070584660 10:77754460-77754482 TTGAATCTATAGATTGCTTTGGG - Intergenic
1070939549 10:80331898-80331920 TTGAATCTATAGATTGCTTTGGG - Intergenic
1071022735 10:81077961-81077983 TTGAATCTATAAATCGCTTTAGG + Intergenic
1071214340 10:83381849-83381871 TTGTATCTACAGATCAAGTTGGG - Intergenic
1071221241 10:83467340-83467362 TTGAATCTGTAGATTGATTTGGG - Intergenic
1071498305 10:86185049-86185071 TTGAATCTATAGATTAATTTGGG + Intronic
1071618946 10:87100931-87100953 TTGAATCTGTAGATCAATTTGGG + Intronic
1071947178 10:90658472-90658494 TTGTATCTACACCACAATTTTGG - Intergenic
1072052268 10:91717576-91717598 TTGAATCTATAGACCAATTTGGG - Intergenic
1072142159 10:92598657-92598679 TTGAATCTATAGATCACTTTGGG + Intronic
1072366010 10:94710445-94710467 TTGAATCTGTAGATCAATTTGGG + Intronic
1072406445 10:95158369-95158391 TTGAATCTACAAATCACTTTGGG - Intergenic
1072489781 10:95893314-95893336 TTGAATTTACAGATTGCTTTTGG - Intronic
1072609613 10:97008723-97008745 TTGAATCTGTAGATCAATTTAGG - Intronic
1072837530 10:98732207-98732229 TTGAATCTATAAATCAATTTAGG - Intronic
1072841717 10:98782434-98782456 TTGAATCTAAAAATCAATTTGGG - Intronic
1072884103 10:99258458-99258480 TTGAATCTACAGAACTATTTTGG - Intergenic
1072908546 10:99478921-99478943 TTGAATCTACAGATCATTTTGGG - Intergenic
1073012003 10:100367847-100367869 TTGAATCTGTAGATCAATTTGGG - Intergenic
1073279093 10:102338919-102338941 TTGAGTCTATAGATCAATTTGGG - Intronic
1073283423 10:102371497-102371519 TTGAATTTACAGATCAATTTGGG - Intronic
1073312440 10:102553047-102553069 TTGTGTCTGCAGATCACTTTAGG + Intronic
1073365073 10:102933198-102933220 TTGCATCTGTAGATCAATTTAGG + Intronic
1074605973 10:114966552-114966574 TTGAAGCTATAGATCAATTTTGG + Intronic
1074612176 10:115032633-115032655 TTGAATCTATAGATTGCTTTGGG + Intergenic
1074619202 10:115100803-115100825 TTGAGTCTATAGATCAATTTTGG + Intronic
1074628805 10:115225793-115225815 TTAAATCTACAGATCAATTTGGG - Intronic
1075179713 10:120199326-120199348 TTGAATCTATAGATTGCTTTGGG + Intergenic
1075501210 10:122976353-122976375 TTGAATCTATAGATCAAGTTGGG - Intronic
1076376252 10:129988400-129988422 TTGAATCTATAGATTGCTTTTGG - Intergenic
1076499038 10:130921373-130921395 CTTTATCTATAGATCAATTTTGG + Intergenic
1076537596 10:131191305-131191327 TTGAATCTGCAGATTGCTTTTGG - Intronic
1076669950 10:132114666-132114688 TTGAATCTATAGATCAATTTGGG + Intronic
1076991061 11:274610-274632 TTGAATCTGTAGATCGATTTGGG + Intergenic
1077202061 11:1313936-1313958 TTGAATCTATAGATTGTTTTGGG + Intergenic
1077290545 11:1788539-1788561 TTGATTCTACAGATCACTTTGGG + Intergenic
1077410573 11:2402091-2402113 TTGGAGCTACTGAGCGATTTTGG - Intronic
1077475174 11:2784596-2784618 TTGAATCTATAGATCCATTTGGG + Intronic
1077753019 11:4994185-4994207 TTGAATCTGTAGATCGATTTGGG - Intergenic
1077824693 11:5793311-5793333 TTGAATCTGCAGATTGCTTTGGG + Intronic
1078050255 11:7959481-7959503 TTGAATCTACAGATCAAACTGGG + Exonic
1078411625 11:11125346-11125368 TTGAATCTATAGATTGCTTTGGG + Intergenic
1078554134 11:12304985-12305007 TTGAATCTATAGATAAATTTGGG + Intronic
1078805592 11:14697647-14697669 TTGTATCTATAGATTAATTTGGG + Intronic
1078881604 11:15454835-15454857 TTGAATCTATAGATCAATTTGGG + Intergenic
1078936903 11:15959852-15959874 TTGCTTCTACAGATCTAGTTTGG + Intergenic
1079072644 11:17361256-17361278 TTGAATCTAGAGATCAAGTTGGG + Intronic
1079107782 11:17583878-17583900 TTGAATTTATAGATCAATTTGGG + Intronic
1079319156 11:19436646-19436668 TTGAATCTATAGATTGCTTTGGG + Intronic
1079823144 11:25157177-25157199 TTGTATCTGTAGATTGCTTTGGG + Intergenic
1079952899 11:26826550-26826572 TTAAATCTATAGGTCGATTTAGG + Intergenic
1080167561 11:29257648-29257670 TTGAATCTATAGATTGCTTTGGG + Intergenic
1080217007 11:29855336-29855358 TTTAATCTATAGATCGCTTTTGG - Intergenic
1080273537 11:30476814-30476836 CTGAATCTACAGATCAATTTAGG + Intronic
1080506696 11:32921702-32921724 TTGAATCTAAACATCAATTTGGG - Intronic
1080530540 11:33171191-33171213 TTGAAACTATAGATCAATTTGGG - Intergenic
1080989994 11:37520589-37520611 TTGAATCTTCAGATTGTTTTAGG - Intergenic
1080998052 11:37629145-37629167 TTACATCTGCAGATCGCTTTAGG + Intergenic
1081327729 11:41766670-41766692 TTGAATCTATAGATCATTTTGGG + Intergenic
1081422355 11:42884360-42884382 TTGAATCTACAGATAAATTTGGG - Intergenic
1081970908 11:47198088-47198110 TTGTTTGTACAGATCCATTTGGG + Intergenic
1082111505 11:48281076-48281098 TTGAATCTGTAGATCGGTTTTGG + Intergenic
1082190882 11:49243211-49243233 TTTAATCTGCAGATCGATTTTGG - Intergenic
1082193273 11:49272577-49272599 TTGTATCTATAAATTGCTTTGGG + Intergenic
1082662526 11:55929719-55929741 TTGGATCTGTAGATCGCTTTAGG + Intergenic
1082689124 11:56278249-56278271 TTGAATCTATAGATTGCTTTTGG + Intergenic
1082886084 11:58084025-58084047 TTGGATCTGTAGATCGCTTTGGG + Intronic
1082908499 11:58341447-58341469 TTGAATCTGCAGATTGCTTTGGG - Intergenic
1083753007 11:64772375-64772397 TTTTACCTATAGATAGATTTTGG - Intronic
1084282887 11:68110622-68110644 TTAAATCTACAGATCAAGTTGGG - Intronic
1084347280 11:68562367-68562389 TTGAATCTGCAGGTCCATTTGGG - Intronic
1084467088 11:69330136-69330158 TTGAATCTGTAGATCCATTTTGG + Intronic
1085106541 11:73848513-73848535 TTGAATCTGTAGATCAATTTGGG + Intronic
1085335901 11:75695146-75695168 TTGAATCTGCAGATTGCTTTGGG + Intergenic
1085443791 11:76586569-76586591 TTGACTCTACAGGTCAATTTGGG + Intergenic
1086000651 11:81980962-81980984 TTGAATCTATAGATCAACTTTGG + Intergenic
1086357582 11:86020294-86020316 TTGAATCTATAGATCAGTTTGGG - Intronic
1086384992 11:86298000-86298022 TTGAATCTGTAGATCAATTTGGG + Intergenic
1086470519 11:87104501-87104523 TTGAATCTATAGATTGCTTTGGG + Intronic
1086568757 11:88258699-88258721 TTGAATCTACAAATCGCTTTAGG + Intergenic
1086672869 11:89568605-89568627 TTGTATCTATAAATTGCTTTGGG - Intergenic
1086675232 11:89597814-89597836 TTTAATCTGTAGATCGATTTTGG + Intergenic
1086780876 11:90904310-90904332 TTGAATCTGTAGATCAATTTGGG - Intergenic
1086827834 11:91521335-91521357 TTTTATCTATAAATCAATTTGGG + Intergenic
1086844940 11:91737305-91737327 TTGTATCTGTAGATCGCTTTGGG - Intergenic
1087018943 11:93582870-93582892 TTGAATCTATAGATTGCTTTGGG + Intergenic
1087031482 11:93709709-93709731 TTGAATCTGCAGATTGCTTTGGG + Intronic
1087043618 11:93825522-93825544 TTGACTCTGCAGATCGCTTTGGG + Intronic
1087133428 11:94690305-94690327 TTGTATCTGTAGATCACTTTGGG - Intergenic
1087201696 11:95351947-95351969 TTGAATCTATAGATTGCTTTGGG - Intergenic
1087378454 11:97373657-97373679 TTGAATCTATAGATTGATTTGGG - Intergenic
1087409102 11:97767962-97767984 TTGAATCTATAGTTTGATTTGGG + Intergenic
1087808670 11:102585176-102585198 TTGAATCTACAGATCAATTTGGG + Intronic
1088018438 11:105089015-105089037 TTGAATCTATAGATTGCTTTAGG - Intronic
1088383966 11:109231046-109231068 TTGAATCTATAGGTCAATTTAGG - Intergenic
1088516708 11:110644228-110644250 TTGAATCTGCAGATTGCTTTGGG - Intronic
1088710343 11:112502390-112502412 TTGAATCTATAGATCAAATTGGG + Intergenic
1088800428 11:113301563-113301585 TTGAATCTACAGATTGCTTTTGG - Intergenic
1088960624 11:114661175-114661197 TTGAATCTATAGATCAATTTTGG - Intergenic
1089087368 11:115833688-115833710 TTAAATCTATAGATCAATTTAGG - Intergenic
1089089987 11:115864575-115864597 TTGAATCTATAGATTGCTTTGGG + Intergenic
1089107047 11:116019583-116019605 TTGAATCTATAGATTAATTTAGG + Intergenic
1089421536 11:118335591-118335613 TTGCATTTATAGATCAATTTGGG - Intergenic
1090112762 11:123933275-123933297 TTGAATCCATAGATCAATTTAGG + Intergenic
1090113051 11:123937044-123937066 TTGAATCTATAGATCAAATTGGG + Intergenic
1090552225 11:127834105-127834127 TTGACTCTATAGATCAATTTAGG - Intergenic
1090561598 11:127938514-127938536 TGGTGTCTACAGATGGCTTTTGG + Intergenic
1090586342 11:128216815-128216837 TTATACCTATAGATCAATTTGGG + Intergenic
1091454318 12:594753-594775 TTGAATCTATAGATCAAGTTAGG - Intronic
1091594031 12:1863488-1863510 TTGAATCTATAAATCAATTTGGG + Intronic
1091830611 12:3547835-3547857 TTAAATCTATAGATCAATTTGGG - Intronic
1091949130 12:4577695-4577717 TTGAATCTACAGATTAAGTTGGG + Intronic
1092609505 12:10156685-10156707 TTGAATCTACAAATCGATTTGGG - Intergenic
1093009792 12:14094555-14094577 TTGAATCTGCAGATGGCTTTGGG - Intergenic
1093063984 12:14637361-14637383 TTGAATCTATAGATTGCTTTGGG - Intronic
1093598824 12:20996652-20996674 TTGAATCTGCAGATTGCTTTGGG + Intergenic
1093631175 12:21411645-21411667 TTGAAGCTACAGATCAATTTGGG + Intronic
1093759088 12:22886124-22886146 TTGAATCTATAGATCAAGTTGGG + Intergenic
1093900806 12:24629663-24629685 TTGAATCTACAGATAAATTTGGG + Intergenic
1093940287 12:25046751-25046773 TTGAATCTATAGATTGCTTTGGG - Intronic
1094446934 12:30541349-30541371 TTGTATCTGTAGATTGCTTTTGG + Intergenic
1094591438 12:31824953-31824975 TTGAATCTGCAGATTGCTTTTGG + Intergenic
1095235735 12:39793395-39793417 TTGACTCTATAGATCAATTTGGG - Intronic
1095833708 12:46614622-46614644 TTGAATCTATAGATGAATTTAGG - Intergenic
1096348642 12:50875011-50875033 TTGAATCTATAGACTGATTTGGG - Intronic
1096936209 12:55280200-55280222 TTGAACCTATAGATCAATTTCGG - Intergenic
1097257609 12:57691984-57692006 TTGAATCTATAGATTGCTTTGGG + Intergenic
1097298742 12:57995975-57995997 TTGAATCTGCAGATCACTTTGGG + Intergenic
1097371775 12:58791465-58791487 TTGAATCTATAGATCACTTTGGG - Intronic
1097729791 12:63115611-63115633 TTGAATCTATAGATTGCTTTGGG - Intergenic
1097965659 12:65577597-65577619 TTGAAGCTACAGATCAATTTGGG - Intergenic
1098491659 12:71088205-71088227 TTGAATCTACAGATTGCTTTGGG + Intronic
1098876893 12:75875042-75875064 TTGAATTTATAGATTGATTTTGG - Intergenic
1098999329 12:77159505-77159527 TTGAATCTATAGATTGCTTTGGG + Intergenic
1099232749 12:80046577-80046599 TTGTTGCTATAGATCAATTTGGG - Intergenic
1099243908 12:80171724-80171746 TTAAATCTACAGATCAATTTGGG + Intergenic
1099244359 12:80177648-80177670 TTTAATCTATAGATCAATTTTGG + Intergenic
1099306426 12:80961940-80961962 TTAAATCTACAGATCAATTTGGG + Intronic
1099432328 12:82602744-82602766 TTGAATCTATAGATTGCTTTGGG - Intergenic
1099534194 12:83825502-83825524 TTGAATCTATAGATTGCTTTGGG + Intergenic
1099803712 12:87490177-87490199 CTGTATCTAGAGAGTGATTTTGG - Intergenic
1100084275 12:90889021-90889043 TTGAATCTGTAGATCTATTTGGG + Intergenic
1100298376 12:93284207-93284229 TTGAATCTATAGATCAATTTAGG - Intergenic
1100462127 12:94810084-94810106 TTGAATCTACATATCACTTTGGG - Intergenic
1100872802 12:98929351-98929373 TTGAATCTGTAGATCAATTTGGG - Intronic
1100896683 12:99190264-99190286 TTGTATCTATAAATTGCTTTGGG - Intronic
1101160645 12:101971322-101971344 TTGAATCTATAGATTGCTTTGGG - Intronic
1101525748 12:105528024-105528046 TTGAATTTATAGATCAATTTTGG + Intergenic
1101536361 12:105620895-105620917 TTGAATCTGCAGATCACTTTGGG + Intergenic
1102104101 12:110305798-110305820 TTGTATCTATAGATGAGTTTGGG + Intronic
1104451789 12:128875186-128875208 TGGTATCTAAAGATTGTTTTTGG - Intronic
1104711005 12:130986216-130986238 TTGAATATATAGATCAATTTGGG + Intronic
1105426346 13:20298173-20298195 TTGTATCTGCATTTGGATTTGGG + Intergenic
1105515173 13:21083223-21083245 TTGAATCTGTAGATCAATTTTGG - Intergenic
1105665050 13:22544913-22544935 TTCAATATATAGATCGATTTGGG + Intergenic
1105682187 13:22740132-22740154 TTGAATCTGTAGATCGCTTTGGG - Intergenic
1105730217 13:23206889-23206911 CTGAATCTACAGATCACTTTTGG - Intronic
1105938525 13:25125880-25125902 TTGAATCTGTAGATCGCTTTGGG - Intergenic
1106045853 13:26141051-26141073 TTGAATCTGTAGATCAATTTGGG - Intronic
1106299997 13:28455076-28455098 TTGAATCTGCAGATCAAGTTGGG - Intronic
1106372636 13:29151109-29151131 TTGAATCTACAGATTGCTTTGGG + Intronic
1106656205 13:31749502-31749524 TTGAATCTATAGATTGATTTAGG + Intronic
1106771644 13:32966834-32966856 TTGAATCTATAGATCAAGTTGGG + Intergenic
1106869553 13:34003871-34003893 TTAAATCTACAGATGGATCTTGG + Intergenic
1107310022 13:39066760-39066782 TTGAATCTATAGATTGCTTTGGG + Intergenic
1107495668 13:40923116-40923138 TTGGATCTATAGATCTGTTTGGG + Intergenic
1107763417 13:43707323-43707345 TTGAATCTACAAATCAACTTTGG - Intronic
1107767542 13:43753235-43753257 TTGAATCTATAGATCAATTTGGG + Intronic
1107843739 13:44488859-44488881 CTGAATCTACAGATGAATTTGGG - Intronic
1108231964 13:48354508-48354530 TTGAATCTATAGATTGCTTTGGG - Intronic
1108295464 13:49012605-49012627 TTGAATCTATAGATTGATTGAGG + Intronic
1108464635 13:50702417-50702439 TTGAATCTACAGATCACTTTAGG - Intronic
1108667945 13:52651793-52651815 TTGAATCTATAGATCTGTTTGGG - Intergenic
1108822536 13:54371057-54371079 TTGAATCTGTAGATTGATTTGGG + Intergenic
1108882689 13:55140438-55140460 TTGAATCTGTAGATTGATTTGGG + Intergenic
1108903240 13:55438798-55438820 TTGAATCTATAGATAAATTTGGG - Intergenic
1108968359 13:56340859-56340881 TTGAATCTACAGATTGCTTTGGG - Intergenic
1108986339 13:56592890-56592912 TTGGATCTATAGATTGCTTTAGG + Intergenic
1109046152 13:57413627-57413649 TTGAATCTATAGATTGCTTTGGG - Intergenic
1109156482 13:58916827-58916849 TTGAATCTATAGATTGTTTTGGG - Intergenic
1109362411 13:61312507-61312529 TTGAATCTATAGATTGCTTTGGG + Intergenic
1109373281 13:61453423-61453445 TTGAATCTGCAGATAGCTTTGGG + Intergenic
1109596104 13:64555978-64556000 TTGAATCTCCAGATCACTTTGGG + Intergenic
1109662596 13:65483903-65483925 TTGAATCTACAGATTGCTTTGGG + Intergenic
1109691569 13:65899032-65899054 TTGAATCTATAGATCATTTTTGG + Intergenic
1109904802 13:68826580-68826602 TTGAATCTATAAATTGATTTGGG - Intergenic
1109920812 13:69055793-69055815 TTGTATTTATAGATTGCTTTGGG - Intergenic
1110047723 13:70851855-70851877 TTGAATTTACACATCAATTTAGG - Intergenic
1110501664 13:76235329-76235351 TTGAATCTACAAATTGCTTTGGG + Intergenic
1110600671 13:77369171-77369193 TTGAATCTATAGATTGTTTTGGG - Intergenic
1110673952 13:78216410-78216432 TTATATTTACAAATCCATTTTGG - Intergenic
1110695965 13:78489630-78489652 TTGGATCTATAGATAAATTTGGG - Intergenic
1110923799 13:81124539-81124561 TTGAATCTACAGATAATTTTAGG + Intergenic
1110933439 13:81252115-81252137 TTAAATCTACAGATATATTTGGG - Intergenic
1111341129 13:86887859-86887881 TTGAATCTATAGATCAATTTGGG - Intergenic
1111479222 13:88800234-88800256 TTGAATCTGTAGATTGATTTGGG + Intergenic
1111558258 13:89909999-89910021 CTGTATCTATAAATCAATTTTGG + Intergenic
1111665977 13:91268493-91268515 TTGAATCTATAGAACAATTTAGG + Intergenic
1111764062 13:92504411-92504433 TTAAATCTACAGATCATTTTGGG - Intronic
1111791131 13:92856901-92856923 TTGAATCTATAGATTGCTTTTGG - Intronic
1112005947 13:95253786-95253808 TTGTCTCTGAAGATGGATTTTGG - Intronic
1112080440 13:95963922-95963944 TTGAATCTATAGATTGCTTTGGG - Intronic
1112618439 13:101029549-101029571 TTGAATCTGTAGATTGATTTGGG + Intergenic
1112715081 13:102175026-102175048 TTGAATCTGCAGATTGCTTTGGG - Intronic
1112940193 13:104852687-104852709 TAGAATCTAGAGATCTATTTGGG - Intergenic
1113026200 13:105944167-105944189 TTTTATCTTCAGATTTATTTTGG - Intergenic
1113208548 13:107946424-107946446 TTGAATCTACAAATTGCTTTGGG - Intergenic
1113275451 13:108723889-108723911 TTGAATCTACAGATCAATTTGGG + Intronic
1113821021 13:113213056-113213078 TAGAATCTACAGATCAATGTAGG + Intronic
1114203469 14:20545367-20545389 TTGAATCTATAGATTGCTTTGGG + Intergenic
1114276291 14:21148371-21148393 TTGAATCTGTAGATCAATTTGGG - Intergenic
1114276613 14:21152263-21152285 TTGAATCTCAAGATCAATTTGGG + Intergenic
1114388027 14:22275768-22275790 TTGAATCTACATATTGCTTTGGG + Intergenic
1114505931 14:23213430-23213452 TTGAATCTATAGATCAAATTGGG - Intronic
1114697184 14:24637358-24637380 TTGAATCTATAGATTGCTTTGGG + Intergenic
1114877931 14:26746245-26746267 TTGCATCTGCAGATTGCTTTGGG - Intergenic
1115113314 14:29850651-29850673 TTGAATCTATAGATTGCTTTGGG - Intronic
1115139261 14:30150220-30150242 TTAAATCTACAGATTGCTTTAGG - Intronic
1115167681 14:30467469-30467491 TTGAATCCACAGAACAATTTGGG - Intergenic
1115169424 14:30487343-30487365 TTGAATCTATAGATCAAGTTGGG - Intergenic
1115325855 14:32137633-32137655 TTGAATCTGTAGATCAATTTGGG + Intronic
1115526812 14:34288979-34289001 TTGAATTTACAGATTGCTTTTGG + Intronic
1115639877 14:35327832-35327854 TTGAATCTATAGATCAAGTTGGG - Intergenic
1115673351 14:35641672-35641694 TTGAACCTATAGATTGATTTGGG - Intronic
1115686542 14:35802596-35802618 TTGAATCTATAGATCAATTTGGG - Intronic
1115719170 14:36141301-36141323 TTGAATCTATAGATCAAGTTGGG + Intergenic
1115915297 14:38305722-38305744 TTGAATCTACAAATTGCTTTGGG - Intergenic
1115930467 14:38486435-38486457 TTGAATCTGTAGATCGCTTTGGG - Intergenic
1116149288 14:41118346-41118368 TTGAATCTATAGATCATTTTGGG - Intergenic
1116301903 14:43193724-43193746 TTGTATCTATACATTAATTTGGG - Intergenic
1116604344 14:46970123-46970145 TTGAATCTATAGATTGCTTTGGG - Intronic
1116664108 14:47753053-47753075 TGGAATCTACAGATCTATTTTGG - Intergenic
1116665782 14:47773186-47773208 TTGAATTTACAGATCAAGTTTGG - Intergenic
1116724770 14:48549025-48549047 TTGAATCTACAGATTGCTTCAGG - Intergenic
1117018020 14:51538928-51538950 TTGAATCTGTAGATCAATTTGGG + Intronic
1117111455 14:52460349-52460371 TTGAATCTATAGATTGCTTTGGG - Intronic
1117360690 14:54970668-54970690 TTGAATCTATAGATTGCTTTGGG - Intronic
1117504049 14:56383408-56383430 TTGAATCTATAGATTGCTTTGGG + Intergenic
1117842612 14:59875695-59875717 TTGAATCTATAGATTGCTTTTGG + Intergenic
1117917697 14:60695115-60695137 TTGAATCTATAGATTGCTTTGGG + Intergenic
1117931368 14:60844293-60844315 TTGGATCTATAGATCAATGTGGG + Intronic
1118103828 14:62636061-62636083 TTGAATCTATAGATCTCTTTGGG - Intergenic
1118182009 14:63503168-63503190 CTGTATGTACAGAGGGATTTTGG + Intronic
1118452302 14:65914441-65914463 TTGAATCTGTAGATCAATTTAGG - Intergenic
1118463286 14:66006773-66006795 TTGAATGTAGAGATCAATTTGGG + Intergenic
1118662024 14:68024402-68024424 TTGAATCTGCAGATTGCTTTGGG + Intronic
1118798195 14:69164403-69164425 TTGAATCTATAGATCACTTTGGG - Intergenic
1118840910 14:69510262-69510284 TTGAATCTATAGATCAAGTTGGG + Intronic
1119202093 14:72763177-72763199 TTGCATCTATAGATCCATTTGGG - Intronic
1119455054 14:74748077-74748099 TTGAATCTGTAGATCGCTTTGGG - Intergenic
1119801159 14:77446517-77446539 TTGAATGTACAGATCAATTTTGG - Intronic
1120078988 14:80193765-80193787 TTGAATCTACAGATCACATTGGG - Intergenic
1120097684 14:80407372-80407394 TTGAATCTGTAGATCGATTTTGG - Intergenic
1120121504 14:80685518-80685540 TTGAATCTGTAGATTGATTTGGG - Intronic
1120368618 14:83603804-83603826 TTGCATCTACAAATTGCTTTGGG + Intergenic
1120620377 14:86756077-86756099 TTGTTTCTGCAGATTGAATTTGG - Intergenic
1121042887 14:90763906-90763928 TTGAATCTGTAGATTGATTTGGG - Intronic
1121157389 14:91699360-91699382 TTGAATCTATAGATAGTTTTGGG - Intronic
1121158889 14:91715591-91715613 TTGAATCTATAGATCAGTTTAGG - Intronic
1121167549 14:91821051-91821073 TTGAATCTGTAGATCAATTTGGG - Intronic
1121316851 14:92966518-92966540 TTGAGTCTATAGATCAATTTGGG - Intronic
1121377195 14:93423285-93423307 TTGAATCTATAGATTGCTTTAGG - Intronic
1121430872 14:93887397-93887419 TTGAATCTATAGATCAAGTTGGG + Intergenic
1121576423 14:94992171-94992193 TTGTCTCTACAGAATGATCTTGG - Intergenic
1121580860 14:95028629-95028651 TTTTATCTACAGATAGGTTTGGG + Intergenic
1122305108 14:100760199-100760221 TTGACTCTACAGATCAATTTGGG - Intergenic
1123453463 15:20390735-20390757 TTGAATCTATAGATCAATTTTGG + Intergenic
1123726216 15:23104547-23104569 TTGAGTCTATAGATCAATTTGGG + Intergenic
1123792954 15:23741130-23741152 TTGAATCTAAAGATTTATTTGGG + Intergenic
1123953089 15:25303691-25303713 TTGAATCTACAGATCACTTTGGG + Intergenic
1124029553 15:25997467-25997489 TTGGATCTACAGATCAACTTGGG + Intergenic
1124114027 15:26822625-26822647 TTGAATCTATAGATTAATTTAGG - Intronic
1124245321 15:28065692-28065714 TTGTATCTAAAGATAAATTAGGG + Intronic
1124361700 15:29041688-29041710 ATGAATCTATAGGTCGATTTGGG - Intronic
1124393402 15:29279690-29279712 TTGAGTCTGCAGATCAATTTGGG + Intronic
1124599624 15:31122752-31122774 TTGCATCTATAGATCAAGTTGGG - Intronic
1124873751 15:33570652-33570674 TTGAATCTAGAGATCAGTTTTGG + Intronic
1125167001 15:36718421-36718443 TTGAATTTACAGATCAATTTGGG + Intronic
1126216603 15:46162529-46162551 TTGAATCTACAGATTGCTTGTGG - Intergenic
1126297826 15:47160952-47160974 TTGAATATATTGATCGATTTGGG - Intergenic
1126520343 15:49585952-49585974 TTGAATCTACATATTGCTTTGGG - Intronic
1126611737 15:50536870-50536892 TTGTATTTACAGATCAAGTTGGG - Intronic
1126658625 15:51008800-51008822 TTGAATCTAAAGATCAAGTTGGG + Intergenic
1127181109 15:56418968-56418990 TTGAATCTATAGATCAGTTTTGG + Intronic
1127208941 15:56751310-56751332 TGGAATCTATAGATCAATTTGGG + Intronic
1127247040 15:57188396-57188418 TTGAATCCACAGATTGCTTTGGG - Intronic
1127697670 15:61467701-61467723 TTGAATGTATAGATCAATTTGGG - Intergenic
1128406689 15:67348690-67348712 TTGAATTTATAGATCAATTTGGG - Intronic
1128421719 15:67497932-67497954 TTGAATCTATAGATCAATTTGGG - Intronic
1130034821 15:80349186-80349208 TTGAATTTATAGATTGATTTTGG + Intronic
1130121471 15:81051881-81051903 TTGAATCTATATATCGCTTTGGG + Intronic
1130440711 15:83950570-83950592 TTGAATCTGTAGATCGCTTTGGG + Intronic
1132034497 15:98470449-98470471 TTGAATCTATAGATAGCTTTGGG - Intronic
1132108210 15:99080939-99080961 TTGATTCTATAGATCAATTTTGG - Intergenic
1132134789 15:99325000-99325022 TTGAATCTGCAGATCAGTTTGGG + Intronic
1132165748 15:99587507-99587529 TTGAATCTATAGATCATTTTAGG + Intronic
1132168453 15:99621489-99621511 TTATATCTACAGGATGATTTGGG + Intronic
1132174300 15:99697656-99697678 TTTAATCTACAGATCAATCTGGG - Intronic
1132614658 16:834428-834450 TTGAATCTGTAGATCAATTTGGG - Intergenic
1133093287 16:3422290-3422312 TTGAATCTACAAATTGCTTTGGG + Intronic
1133540310 16:6746186-6746208 TTGAATCTACAGATCAATTAGGG - Intronic
1133863626 16:9620577-9620599 TTGAATCTATAGATCAAATTAGG - Intergenic
1134438162 16:14280879-14280901 TTGAATCTACAGATGAATTTGGG - Intergenic
1134534062 16:15010999-15011021 TTGAATCTACAGATTAGTTTGGG - Intronic
1135036336 16:19080513-19080535 TTGAAGCTAAAGTTCGATTTGGG - Intergenic
1135224001 16:20639640-20639662 TTCTTTCTGCAGATAGATTTGGG + Intronic
1135273732 16:21092038-21092060 TTGAATCTATAGATCAAGTTGGG - Intronic
1135795558 16:25438420-25438442 TTAAATCTACAGATAAATTTGGG + Intergenic
1135996076 16:27249828-27249850 TTGAATCTATAGATCAATTTGGG + Intronic
1136389512 16:29953697-29953719 TTGAAACTGCAGATCGCTTTGGG + Intronic
1137337760 16:47567160-47567182 TTGAATCTATAGATTGCTTTGGG + Intronic
1137379982 16:47988587-47988609 TTGAATCTATAGATCACTTTGGG - Intergenic
1137436634 16:48459875-48459897 TTGAATCTATAGATCAAGTTAGG + Intergenic
1137703123 16:50512474-50512496 TTGAATCTACAGTTTGATTTGGG + Intergenic
1138401879 16:56752576-56752598 TTGAATCTGCAGACCAATTTAGG - Intronic
1138906592 16:61342713-61342735 TTGAATCTACAGATTGCTTTGGG - Intergenic
1138994711 16:62435345-62435367 TTGCTTCTAGAGATCTATTTTGG - Intergenic
1139153476 16:64412974-64412996 TTGAATCTGCAGATTGCTTTGGG + Intergenic
1139160610 16:64503275-64503297 TTGAATCTATAGATTGCTTTGGG + Intergenic
1139370345 16:66464197-66464219 TTGAATCTTCAGATGAATTTGGG + Intronic
1139861973 16:70029727-70029749 TTGAATCTACAGATTAGTTTGGG + Intergenic
1140116404 16:72045439-72045461 TTGAATCTCCAGATCACTTTGGG - Intronic
1140625871 16:76793867-76793889 TTTTATCTACAGATTGTGTTTGG - Intergenic
1140693452 16:77507734-77507756 GTGAATCTAGAGATCAATTTGGG + Intergenic
1141902462 16:87000870-87000892 CTGAATCTATAGATCGATTTGGG - Intergenic
1142055373 16:87991463-87991485 TTGAATCTGTAGATCAATTTGGG + Intronic
1142524431 17:529480-529502 TTCTATCTATAGATTAATTTTGG + Intronic
1143254930 17:5549013-5549035 TTGAATCTATAGATCAGTTTGGG + Intronic
1143308111 17:5964809-5964831 TTGAATCTATAGATCAAGTTAGG + Intronic
1143725959 17:8846528-8846550 TTGAATCTGCAGATTGCTTTGGG + Intronic
1143989892 17:10948323-10948345 TTGAATCTACAGATCAAGTTTGG + Intergenic
1144048463 17:11474914-11474936 TTGAATCTATAGATCAAGTTGGG + Intronic
1144164249 17:12592579-12592601 TTGAATCTATTGATTGATTTGGG + Intergenic
1145805521 17:27725628-27725650 TTTAATCTAGAGATCCATTTGGG + Intergenic
1146802344 17:35836189-35836211 GTGTGTCTACAGATCAAGTTGGG + Exonic
1146839694 17:36142155-36142177 TTGAATCTATAGATTAATTTGGG - Intergenic
1147723765 17:42554187-42554209 TTGTAGCCTCAGATGGATTTGGG + Intronic
1148247187 17:46040714-46040736 CTGACTCTACAGATCAATTTGGG + Intronic
1148764845 17:50031707-50031729 TTGAATCTATAGATTGATTTGGG - Intergenic
1148994276 17:51695220-51695242 TTGAATCTACAGATTGCTTTGGG + Intronic
1149090088 17:52767678-52767700 TTGAATCTATAGATTGCTTTGGG - Intergenic
1149172588 17:53829198-53829220 ATGTAACTACTGATAGATTTAGG + Intergenic
1149411761 17:56415638-56415660 TTGAATCTATAGATTGCTTTGGG - Intronic
1149977048 17:61276608-61276630 TTGAATCTGTAGATCAATTTGGG - Intronic
1150312768 17:64142669-64142691 TTGAATCTGTAGATCAATTTGGG - Intergenic
1150461101 17:65353644-65353666 TTGAATCTACAGATCAGTTTAGG - Intergenic
1150480987 17:65510453-65510475 CTGAATCTATAGATCAATTTGGG - Intergenic
1150529937 17:65966900-65966922 TTGAATCTGTAGATCAATTTGGG - Intronic
1150548083 17:66183413-66183435 TTAAATCTACAGGTCAATTTGGG - Intronic
1151374540 17:73677371-73677393 TTGAATGTATAGATTGATTTGGG - Intergenic
1152010811 17:77713553-77713575 TTGTATATATAAATCAATTTGGG + Intergenic
1152518798 17:80843161-80843183 GTTAATCTACAGATTGATTTGGG + Intronic
1153352435 18:4095919-4095941 TTGTTTCTGCTGATCGATTCAGG - Intronic
1153503976 18:5776452-5776474 TTGTATCTGCAGATCAATTTAGG + Intergenic
1153613932 18:6916813-6916835 TTGTGTCTACAGGTCCATTTGGG - Intergenic
1153751358 18:8234179-8234201 CTGAATCTATAGATCAATTTGGG + Intronic
1153873855 18:9347403-9347425 TTGAATCTGTAGATCAATTTGGG + Intronic
1154282804 18:13021673-13021695 TTGAATCTACAGGTCACTTTGGG + Intronic
1154948947 18:21189216-21189238 TTGAATCTACAGATCACTTTTGG + Intergenic
1155068355 18:22288609-22288631 TTGAATCTATAGATTGATTTGGG + Intergenic
1155098297 18:22581459-22581481 TTGAATCTAAAAATCAATTTGGG + Intergenic
1155141305 18:23047049-23047071 ATGTATCTTCAGTTGGATTTTGG + Intergenic
1155513602 18:26601582-26601604 TTGAATCTGCAGATCAATTTGGG + Intronic
1155998760 18:32360542-32360564 TTGTATCTACAGATCTTTTTTGG + Intronic
1156025539 18:32649973-32649995 TTGAATCTATAGATTGCTTTGGG + Intergenic
1156052013 18:32948265-32948287 TTGAATCTTTAGATCAATTTGGG + Intronic
1156259750 18:35434297-35434319 TTGAATCTATAGGTCAATTTGGG + Intergenic
1156400938 18:36739531-36739553 TTAAATCTATAGATCAATTTTGG + Intronic
1156429204 18:37052917-37052939 CTGAATCTATAAATCGATTTGGG - Intronic
1157244819 18:46044062-46044084 TTGGATCTATAGATCAATTTGGG - Intronic
1157275258 18:46305752-46305774 TTGGATCTATAGATCAATCTGGG + Intergenic
1157509324 18:48258613-48258635 TTGAATCTACAGATCAATTTGGG - Intronic
1157845174 18:50997153-50997175 TTGAAACTACAGATAAATTTAGG - Intronic
1157961840 18:52162981-52163003 TTGAATCTATAGATCAATTTGGG + Intergenic
1158117118 18:54008157-54008179 TTGAATCTACAGATTGCTTTGGG - Intergenic
1158160412 18:54476285-54476307 TTGAATCTATAGACCCATTTGGG - Intergenic
1158261892 18:55615149-55615171 TTGAATCTATAGATTAATTTGGG + Intronic
1158486713 18:57873759-57873781 TTGAATCTGTAGATCAATTTAGG - Intergenic
1158698942 18:59729208-59729230 TTGTATCTATTGAAAGATTTTGG + Intergenic
1158747861 18:60222282-60222304 TTGAGTCTACAGATTGCTTTCGG + Intergenic
1159091595 18:63855306-63855328 TTGAATCTATAGATTGTTTTGGG + Intergenic
1159111390 18:64060543-64060565 TTGAATCTTCAGATTGCTTTCGG + Intergenic
1159416626 18:68157806-68157828 TTGAATCTACAAATTTATTTGGG + Intergenic
1159483295 18:69019275-69019297 TTGAATCTGCAGATAGCTTTGGG + Intronic
1159564673 18:70035138-70035160 TTGAATCTACAAATTGCTTTGGG - Intronic
1159579831 18:70222652-70222674 TTGAATCTGCAGATCAATTTGGG - Intergenic
1159588488 18:70305625-70305647 TTGAATCTATAGATCAATTTTGG + Intronic
1159632683 18:70767254-70767276 TTGAATCTATAAATTGATTTGGG - Intergenic
1159698136 18:71587559-71587581 TTTTATCTATAGATCTATTTAGG + Intergenic
1159730997 18:72027623-72027645 TTGAATCTATAGATTGCTTTGGG + Intergenic
1159818418 18:73107417-73107439 TTTTATCTATAGATCAATTTGGG + Intergenic
1159906931 18:74101538-74101560 TTGAATTTATAGATCGCTTTTGG - Intronic
1159998144 18:74987875-74987897 TTGAATCTATAGATCAATGTGGG - Intronic
1160056384 18:75485569-75485591 TTGAATCTAAAGATCAAATTAGG - Intergenic
1160104229 18:75955366-75955388 TTAAATCTACAGATTGTTTTAGG - Intergenic
1160361187 18:78281217-78281239 TTGAATCTGCAGATTGCTTTGGG + Intergenic
1160472616 18:79151017-79151039 CTGAATCTACAGATCAATTTAGG - Intronic
1160536229 18:79595257-79595279 TTGAATCTATAGATCAAATTGGG - Intergenic
1160547662 18:79671394-79671416 TTGACTCTATAGATCGATTTGGG + Intergenic
1160570199 18:79811153-79811175 TTGAATCTATAGATCAGTTTGGG - Intergenic
1160627561 18:80222422-80222444 TTGAATCTGTAGATCAATTTGGG - Intronic
1161184791 19:2910038-2910060 TTGAATCTATAGATCAAGTTGGG + Intronic
1161639100 19:5408887-5408909 TTGAATCTACAGATCGGTTAAGG + Intergenic
1161881971 19:6961447-6961469 TTGGATCTATAGATCAAGTTGGG + Intergenic
1162251808 19:9451046-9451068 TTGAATCTGCAGATTGCTTTAGG - Intergenic
1162664502 19:12198490-12198512 TTGAATCTGCAGATTGCTTTGGG + Intergenic
1162669180 19:12240102-12240124 TTGTATCTGTAGATTAATTTGGG - Intronic
1163226852 19:15968490-15968512 TTGAATCTATAGATCAAGTTGGG - Intergenic
1163379134 19:16952791-16952813 TTGAATCTATAGATCACTTTGGG - Intronic
1164887298 19:31791870-31791892 TTGAATCAATAGATCAATTTGGG - Intergenic
1164893784 19:31850296-31850318 TTGAATCTATAGATCAAGTTGGG - Intergenic
1164962747 19:32449346-32449368 TTGAATCTGTAGATCAATTTGGG - Intronic
1165250480 19:34529388-34529410 TTGAATCTGCAGATCATTTTTGG + Intergenic
1165264828 19:34651703-34651725 TTGAATCTGCAGATCACTTTTGG - Intronic
1165271926 19:34716337-34716359 TTGAATCTGCAGATCACTTTTGG - Intergenic
1165343865 19:35231362-35231384 TTGAATCTAAAGATAAATTTGGG - Intergenic
1165638072 19:37360502-37360524 TTGAATCTGCAGATAAATTTTGG + Intronic
1165645993 19:37437896-37437918 TTGAATCTATAGATTGCTTTAGG - Intronic
1165681050 19:37776058-37776080 TTGAATTTATAGATCGCTTTTGG - Intronic
1165965274 19:39572572-39572594 TTGGATCTACAAATTGCTTTGGG + Intergenic
1166578099 19:43864354-43864376 TTGAATCTTCATATCAATTTGGG - Intergenic
1166910509 19:46151938-46151960 TTGATTCTATAGATCAATTTGGG + Intronic
1166922997 19:46244243-46244265 TTGAATATATAGATCAATTTGGG - Intergenic
1166973282 19:46585964-46585986 TTGAATCTGCAGTTCTATTTGGG - Intronic
1167398393 19:49247093-49247115 TTGAATCTGTAGATCAATTTGGG + Intergenic
1167957738 19:53080646-53080668 TTGAATCTATAGATTGCTTTGGG - Intronic
1168662346 19:58177238-58177260 TTGTATCTAGTGATGAATTTGGG + Intergenic
925113571 2:1356735-1356757 TTGAATCTATAGATCACTTTGGG + Intronic
925145172 2:1577817-1577839 TTGAATCTATAAATCAATTTCGG - Intergenic
925192411 2:1895280-1895302 TTGAATCTGCAGATTGCTTTGGG - Intronic
925335112 2:3092416-3092438 TTGAATCTGCAGATCACTTTGGG - Intergenic
925335214 2:3093742-3093764 TTAAACCTACAGATCAATTTGGG + Intergenic
925534086 2:4897878-4897900 TTGAATCTGTAGATCGATTTGGG - Intergenic
926481829 2:13408489-13408511 TTGAATCTATAGATCAATTTTGG - Intergenic
926804766 2:16697276-16697298 TTGAATCTATAGATTGCTTTGGG + Intergenic
926873052 2:17444645-17444667 TTTAATCTACAGAGCAATTTAGG - Intergenic
926887047 2:17607360-17607382 TTGTATCTCCAGATCAAAGTAGG - Intronic
926926345 2:17992122-17992144 CTGAATCTAGAGATTGATTTTGG + Intronic
927014163 2:18939349-18939371 TTGAATCTACAGGTCATTTTGGG + Intergenic
927016414 2:18967157-18967179 TTTTATCTGCAGATTGCTTTGGG + Intergenic
927237757 2:20890791-20890813 TTGCATCTGTAGATCAATTTGGG + Intergenic
927349837 2:22097243-22097265 TTGCATCTACAGATACATATCGG - Intergenic
927573989 2:24185531-24185553 TTGAATCTGTAGATCAATTTGGG + Intronic
927728709 2:25450610-25450632 TTAAATCTATAGATCAATTTAGG + Intronic
928050097 2:27983524-27983546 TGGGATCTACAGATCAACTTGGG + Intronic
928483835 2:31709647-31709669 TTGAATCTATAAATCAATTTGGG + Intergenic
928643839 2:33329946-33329968 TTGAATCAATAGATCAATTTGGG + Intronic
928768344 2:34674874-34674896 TTGAATCTGTAGATTGATTTGGG - Intergenic
928851164 2:35748909-35748931 TTGAATCTGTAGATCAATTTGGG - Intergenic
928932872 2:36643274-36643296 TTGAATCTATAGATTGCTTTGGG - Intronic
929012872 2:37463383-37463405 TTGTATCTATAGATCACTTCAGG + Intergenic
929301947 2:40314570-40314592 TTGAATCTCTAGATCAATTTGGG + Intronic
929463207 2:42120890-42120912 TTGAATCTACAGATCTATTAGGG + Intergenic
929491712 2:42402951-42402973 TTGAATTTATAGATCAATTTGGG + Intronic
929497841 2:42461918-42461940 TTTTATCTACAGAACAACTTGGG + Intronic
929734768 2:44536281-44536303 TTGAATCTACAGATTTCTTTGGG - Intronic
929900367 2:45995932-45995954 TTGAATATATAGATCGAGTTTGG + Intronic
929906718 2:46052569-46052591 TTGAATGTAGAGATCAATTTGGG - Intronic
929952260 2:46422363-46422385 TTGAATCTATAGATCAGTTTTGG - Intergenic
930450424 2:51529363-51529385 TTGAATCAATAGATCAATTTAGG + Intergenic
930474673 2:51866319-51866341 TTGAATTTACAGATTGCTTTTGG + Intergenic
930537531 2:52662846-52662868 TTGAATCTATAGATAAATTTTGG - Intergenic
930567871 2:53045899-53045921 TTGAATCTATAGATCACTTTGGG + Intergenic
930596510 2:53395858-53395880 TTATATCTACACCTCAATTTTGG - Intergenic
930628260 2:53723265-53723287 TTGAATCTATAGATTGCTTTGGG - Intronic
930875853 2:56214938-56214960 TTGAACCTACAGATCAAGTTGGG + Intronic
930951785 2:57151457-57151479 TTGAATCTACAAATTGTTTTGGG - Intergenic
930965430 2:57318169-57318191 TTGTATCTATAAATTGCTTTGGG - Intergenic
931085549 2:58826205-58826227 TTGAATCTGCAGATTGCTTTGGG + Intergenic
931521453 2:63101759-63101781 TTGAATCTATAGATTGCTTTGGG + Intergenic
931545822 2:63385687-63385709 TTGGATCTATAGATCATTTTAGG - Intronic
931736876 2:65203324-65203346 TTGAATCTATAGATTGCTTTGGG - Intergenic
931965306 2:67526968-67526990 TTGAATCTACAGATAAAGTTGGG - Intergenic
931993414 2:67814489-67814511 TTGAATATATAGATCAATTTAGG - Intergenic
932189521 2:69728925-69728947 TTGAATTTATAGATCAATTTGGG + Intronic
932286347 2:70535412-70535434 ATGTATCTACATATTTATTTTGG - Intronic
932395163 2:71439869-71439891 TTGGATCTGCAGATTGCTTTGGG + Intergenic
932743368 2:74309589-74309611 TTGCATCTATAGATCAAGTTGGG + Intronic
932931079 2:76040103-76040125 TTGTATCTGTAGATAGCTTTGGG - Intergenic
933005786 2:76992698-76992720 TTGAATCTACAGGTTGTTTTGGG - Intronic
933553041 2:83798580-83798602 TTGAATCTGTAGATCTATTTGGG + Intergenic
933605669 2:84380156-84380178 TTGAATCTGCAGATTGGTTTTGG - Intergenic
933807056 2:86006520-86006542 TTGAATCTGTAGATCGCTTTAGG - Intergenic
933838817 2:86268554-86268576 TTGAATCTATAGATCAAGTTGGG - Intronic
933855388 2:86408943-86408965 TTGAATCTATAGATAAATTTGGG - Intergenic
934016003 2:87882659-87882681 TTGAATTTATAGATCAATTTGGG + Intergenic
934536118 2:95135158-95135180 TTGAATCTGTAGATCAATTTGGG + Intronic
934920328 2:98338872-98338894 TGGAATCAACAGATCAATTTTGG + Intronic
934959298 2:98654721-98654743 TTGAATCTGTAGATCGCTTTAGG - Intronic
935093559 2:99921055-99921077 TTGAATCTTTAGATCAATTTGGG - Intronic
935288235 2:101585343-101585365 TTGAATCTATAGATTGCTTTGGG + Intergenic
935531919 2:104243973-104243995 TTGAATCTATAGATCACTTTGGG - Intergenic
935764203 2:106348784-106348806 TTGAATCTATAGATTGCTTTAGG + Intergenic
935835359 2:107046133-107046155 TTGAATTTACAGATTAATTTGGG - Intergenic
935995981 2:108773595-108773617 TTAAATCTATAGATCAATTTCGG - Intronic
936001613 2:108836629-108836651 TTGAATCTGTAGATCGCTTTGGG + Intronic
936005167 2:108880342-108880364 TTGTATCTATAGATCAAGTTGGG - Intronic
936120828 2:109742596-109742618 TTGGATCTACAGATTAAGTTGGG - Intergenic
936223869 2:110628877-110628899 TTGGATCTACAGATTAAGTTGGG + Intergenic
936255962 2:110912191-110912213 TTATATCTACAGATTAATTTAGG - Intronic
936268095 2:111026342-111026364 TTGCATCTATAGATCAATATGGG + Intronic
936498411 2:113044032-113044054 TTGGATCTACAGGTCAAGTTGGG + Intronic
936602089 2:113907011-113907033 TTGAATCTGTGGATCGATTTGGG + Intronic
936736834 2:115455390-115455412 TTGAATCTATAAATCAATTTGGG - Intronic
936781027 2:116032759-116032781 CTGAATCTATAGATCAATTTTGG + Intergenic
937135858 2:119551815-119551837 TTGAATCTGTAGATCAATTTGGG + Intronic
937611052 2:123861811-123861833 TTGAATCTGTAGATCGCTTTGGG - Intergenic
937618852 2:123961713-123961735 TTGAATCTACAGATTGCTTTGGG - Intergenic
937618878 2:123962126-123962148 TTGAATCTACAGATTGTTTTGGG - Intergenic
937777630 2:125798661-125798683 TTGAATCTAAAGATTGCTTTGGG - Intergenic
937897983 2:126992874-126992896 TTGTATCTATTGATCGTTTGTGG - Intergenic
937954409 2:127412930-127412952 TTGAATCTATAGAACAATTTAGG - Intergenic
937961243 2:127461151-127461173 TTGCATCTATAGATCAATTTGGG - Intronic
938223321 2:129591965-129591987 TTATATCTGTAGATCAATTTGGG - Intergenic
938554326 2:132410533-132410555 TTGAATCTATAGATCAATTTTGG + Intergenic
938700077 2:133869405-133869427 TTGAATCTATAGATCACTTTGGG - Intergenic
938815164 2:134895470-134895492 TTGGATCTGTAGATCAATTTGGG - Intronic
938944384 2:136198253-136198275 TTGAATCTATAGATTGCTTTGGG + Intergenic
939110112 2:137996595-137996617 TTGAATCTATAAATCAATTTGGG - Intronic
940010122 2:149044194-149044216 TTAAATCTACAGATTAATTTAGG + Intronic
940383106 2:153038727-153038749 TTGAATCTATAGATCATTTTAGG + Intergenic
940433047 2:153616494-153616516 TTGAATCTATAGATTGCTTTGGG + Intergenic
940563186 2:155327879-155327901 TTAAATCTACAGATCGCTTTGGG - Intergenic
940582975 2:155604495-155604517 TTGAATCTATAGATTGCTTTGGG + Intergenic
940714156 2:157200147-157200169 TTGAATCTATAGATCAAGTTGGG - Intergenic
940785571 2:157977486-157977508 TTGAATCTATAGATTGCTTTGGG + Intronic
940852038 2:158697134-158697156 TTGAATCTATAGATCAAGTTGGG - Intergenic
941034164 2:160548658-160548680 TTGAATCTACAGAGGAATTTTGG + Intergenic
941259632 2:163280904-163280926 TTCAATCTACAGACCAATTTGGG - Intergenic
941587208 2:167375407-167375429 TTGAATCTATAGATTGCTTTGGG + Intergenic
941873988 2:170414647-170414669 TTAAATCTACAGATGAATTTAGG + Intronic
941973376 2:171376775-171376797 TTGAATCTATAGATTGCTTTTGG - Intronic
942235544 2:173900872-173900894 TTGAATCTATAGATTAATTTGGG - Intergenic
942271427 2:174279493-174279515 TTGAATCTATAGATCAATTTGGG + Intergenic
942493746 2:176517235-176517257 TTGAATCAATAGATCAATTTTGG + Intergenic
942532787 2:176930149-176930171 TTGAATTTACAAATCAATTTAGG - Intergenic
942757076 2:179353999-179354021 TTGAATTTACAGATTAATTTAGG + Intergenic
942792917 2:179781069-179781091 TTGAATCTACAGATTAATTGGGG - Intronic
942817887 2:180074080-180074102 TTGAATCTATAGATTGCTTTGGG - Intergenic
942834151 2:180272728-180272750 TTGAATCTGCAGATTGGTTTGGG + Intergenic
942887587 2:180945964-180945986 TTGAATGTATAGATCAATTTGGG + Intergenic
943076243 2:183198968-183198990 TTATATCTACATATCACTTTGGG - Intergenic
943117132 2:183686905-183686927 TTGAATCTGCAGATTGCTTTGGG + Intergenic
943419140 2:187646930-187646952 TATTATCTGCAGATTGATTTTGG + Intergenic
943606145 2:189979004-189979026 TTGAATCTATAGATTGCTTTGGG - Intronic
943638252 2:190330310-190330332 TTGAATCTGCAGATTGCTTTGGG - Intronic
943667319 2:190623241-190623263 TTGAATCTGCAGATTGCTTTGGG - Intergenic
943818008 2:192280641-192280663 TTGAATCTACAGATTGCTTTGGG + Intergenic
943932673 2:193874535-193874557 GTGAATCTAAAGATCGAGTTGGG + Intergenic
944045029 2:195401307-195401329 TTGAATCTATAGATCAATCTGGG - Intergenic
944640609 2:201721236-201721258 TTGAATCTATAGATTAATTTGGG - Intronic
945000077 2:205340148-205340170 TTGAATCTATAGATTGCTTTGGG + Intronic
945327836 2:208503348-208503370 TTGAATCTATAGATCAATTTTGG + Intronic
945403011 2:209410647-209410669 TTGAATCTATAGATCGGTTTGGG - Intergenic
945475781 2:210280799-210280821 TTGAATCTATAGATCACTTTTGG + Intergenic
945528162 2:210914971-210914993 TTGTATCTGTAGATTGCTTTGGG - Intergenic
945843819 2:214919301-214919323 TTGAATCTATAGATAGATTTGGG - Intergenic
945866098 2:215177569-215177591 TTGAATCTATAGATGGCTTTGGG + Intergenic
945880854 2:215323372-215323394 TTGAATCTGTAGATCAATTTGGG + Intronic
945953198 2:216059956-216059978 CTGAATCTACAGATCAATTTGGG + Intronic
946082847 2:217139555-217139577 TTGAATCTATAGATTGCTTTGGG + Intergenic
946218456 2:218204882-218204904 TTGAATCTATAGATTGCTTTGGG + Intergenic
947030696 2:225790193-225790215 TTGAATCTATAGATCAAGTTAGG + Intergenic
947043887 2:225955044-225955066 TTGAATCTGTAGATCGAGTTGGG - Intergenic
947475229 2:230440620-230440642 TTGAAGCTACAGATAAATTTGGG - Intronic
947683655 2:232060722-232060744 TTGAATCTATAGATTGCTTTGGG + Intronic
947920735 2:233869636-233869658 TTGAATCTATAGATCAATTAGGG + Intergenic
948078587 2:235187035-235187057 TTGAATCTACAAATTGCTTTGGG - Intergenic
948201337 2:236131465-236131487 GTGTATCCACAGATGGGTTTAGG + Exonic
948416076 2:237805411-237805433 TTGAATCTGTAGATTGATTTGGG - Intronic
948532810 2:238623139-238623161 TTGAATCTATAGATTGCTTTGGG - Intergenic
1168907097 20:1414731-1414753 TTGAACCTACAGATAAATTTGGG - Intergenic
1169183046 20:3587795-3587817 TTGAATCTACTGACCAATTTGGG + Intronic
1169734124 20:8818966-8818988 TTTAATCTATAGATCAATTTGGG - Intronic
1170023053 20:11857186-11857208 TTGAATCTATAGATCTATTTAGG + Intergenic
1170056149 20:12205543-12205565 TTGTATCTGTAGATTGCTTTGGG + Intergenic
1170161491 20:13317365-13317387 TTGAATCTATAGATCAAGTTGGG - Intergenic
1170242560 20:14184597-14184619 TTGAATCTACAAATTGCTTTGGG + Intronic
1170378152 20:15725159-15725181 TTGAATCTATAGATCAAGTTGGG + Intronic
1170402036 20:15997270-15997292 TTGAATGTATAGATCGATTTAGG + Intronic
1170521495 20:17190384-17190406 TTGCATCTACATAACCATTTTGG - Intergenic
1172078844 20:32322075-32322097 TTGAATCTGTAGATCAATTTGGG + Intronic
1172089235 20:32416033-32416055 TTGAATCTACAAATCAAATTGGG - Intronic
1172130903 20:32654416-32654438 TTGAATCTGAAGATCAATTTGGG - Intergenic
1172785115 20:37463675-37463697 TTGAATCTATAGATCAATTTGGG + Intergenic
1172813161 20:37665350-37665372 TTGAATCTGTAGATCCATTTGGG + Intergenic
1173220887 20:41132179-41132201 TTGGAGCCACAGATAGATTTGGG + Intergenic
1173604041 20:44317074-44317096 TTGAATCTATAGCTCGCTTTGGG - Intergenic
1174695802 20:52556500-52556522 TTGAATCTATAGATTGCTTTGGG + Intergenic
1175043739 20:56082003-56082025 TTGGATATATAGATCAATTTGGG + Intergenic
1175142454 20:56871072-56871094 CTGTATCTACAGATCTCTGTGGG + Intergenic
1175316429 20:58051122-58051144 TTGAATCTGCATATCAATTTGGG - Intergenic
1175317809 20:58063704-58063726 TTGAATCTACGGATCAACTTGGG - Intergenic
1175830731 20:61964348-61964370 TTGAATCTACAAATTGATTTGGG - Intronic
1176876415 21:14134368-14134390 TTGAATCTATAGATTGCTTTGGG - Intronic
1176982013 21:15393148-15393170 TTGAATCTACAGATTGCTTTGGG + Intergenic
1176995135 21:15546287-15546309 TTGAATCTGCAGATTGCTTTGGG - Intergenic
1177011699 21:15738358-15738380 TTGAATCTGTAGATCCATTTGGG + Intronic
1177043584 21:16143103-16143125 TTGTATCTATAAATTGCTTTGGG + Intergenic
1177066975 21:16450830-16450852 TTATTTCTACAGATTTATTTTGG + Intergenic
1177125498 21:17188406-17188428 TTGAATCTATAGATCAATTTGGG - Intergenic
1177616449 21:23527918-23527940 TTGAATCTATAGATTGTTTTGGG + Intergenic
1177799221 21:25811396-25811418 TTGAATCTATAGATCAATTTGGG - Intergenic
1177843504 21:26261186-26261208 TTGAATCTATAGATCAGTTTGGG + Intergenic
1178031500 21:28531867-28531889 TTGAATCTATAGATCAAGTTGGG + Intergenic
1178483317 21:32999506-32999528 TGGAATCTATAGATCAATTTGGG - Intergenic
1180121792 21:45756499-45756521 TTGGATCTGCAGAACAATTTGGG + Intronic
1181713954 22:24710654-24710676 TTGAATCTAGAGATCACTTTAGG - Intergenic
1181912485 22:26250725-26250747 TTGTATCTGTAGATCACTTTTGG + Intronic
1182054740 22:27342093-27342115 TTGAATCCATAGATCAATTTAGG + Intergenic
1182142289 22:27970971-27970993 TTGAATCTATAAATCAATTTGGG + Intergenic
1182164374 22:28158333-28158355 TTGAATCTATAGATTGCTTTGGG - Intronic
1182400491 22:30072779-30072801 TTGAATCTGTAGATCAATTTGGG - Intergenic
1182407338 22:30147110-30147132 TTGAATGTATAGATCAATTTGGG - Intronic
1182824263 22:33250102-33250124 TTGAATCTACAGATAAAGTTAGG + Intronic
1183067609 22:35373884-35373906 TTGTTTGTACAGATTTATTTTGG - Intergenic
1183133288 22:35860752-35860774 CTGAATCTACAGATCACTTTGGG + Intronic
1183609335 22:38887431-38887453 TTGAATCTATAGATTGCTTTGGG - Intergenic
1183694159 22:39410776-39410798 TTAAATCTACAGATCAATTTGGG - Intronic
1183766728 22:39884121-39884143 TTGAATCTGTAGATCAATTTGGG - Intronic
1184613216 22:45619253-45619275 TTGAATCTATAGATGGATTTAGG + Intergenic
1184621284 22:45680397-45680419 TTGAATCCACAGGTCAATTTGGG - Intronic
1184623149 22:45698524-45698546 TTGAATCTATAGATCAATTGGGG + Intronic
1185049611 22:48547089-48547111 TTGTTTCTACACTTCAATTTTGG - Intronic
1185164149 22:49248627-49248649 TTGAATCTATAGATCAATTTAGG + Intergenic
1185350589 22:50335005-50335027 TTGGATCCACAGATCAATTTGGG + Intergenic
1185424625 22:50759744-50759766 TTGAATTTGCAGATCAATTTGGG + Intergenic
949362355 3:3245030-3245052 TAGTATCTACAAATCCCTTTTGG - Intergenic
949389875 3:3548423-3548445 TTGAATCTATAGATCAAGTTAGG + Intergenic
949746229 3:7295562-7295584 TTGAATCTATAGATAGATTTGGG + Intronic
949800606 3:7899789-7899811 TTGAATCTGTAGATTGATTTGGG - Intergenic
949870667 3:8585159-8585181 TTGAATCAACAGGTCAATTTGGG + Intergenic
949870746 3:8586122-8586144 TGGAATCAACAGATCAATTTGGG + Intergenic
949915267 3:8957247-8957269 TTGAATCTAGAGATCAATTTGGG - Intronic
950321764 3:12061944-12061966 CTGCATCTACAGATCAAGTTGGG - Intronic
950337496 3:12208838-12208860 TTTAATCTAAAGATCAATTTGGG + Intergenic
950341475 3:12249518-12249540 TTGAATCTGCAGATTGCTTTGGG - Intergenic
950347263 3:12307894-12307916 TTGTGTTTAGAGATAGATTTGGG + Intronic
950352148 3:12365969-12365991 TTGAATCTATAGATCAAGTTGGG + Intronic
950735074 3:15000738-15000760 TTGAATCTTTAGATCAATTTGGG + Intronic
950828327 3:15849223-15849245 TTGAATCAATAGATCAATTTGGG - Intronic
950843517 3:15990769-15990791 TTGAATCTATAGATCAATTTGGG + Intergenic
950927376 3:16755082-16755104 TTGAATCTATAGATTGTTTTGGG + Intergenic
950994137 3:17476662-17476684 CTGAATCTATAGATCAATTTGGG + Intronic
951200496 3:19871676-19871698 TTGAATCTAAAGATCAGTTTGGG - Intergenic
951376932 3:21929874-21929896 TTAAATCTATAGATCAATTTGGG - Intronic
951435577 3:22659545-22659567 TTGTATCTGTAGATAAATTTGGG - Intergenic
951524087 3:23636694-23636716 TTGAATCTATAAATCCATTTGGG + Intergenic
951616631 3:24553997-24554019 TTGAATCTGCAGATCAATTTTGG + Intergenic
951758853 3:26122766-26122788 TTGAATCTGCAGATTGCTTTAGG - Intergenic
952233719 3:31457491-31457513 TTGAATCTATAGATTGCTTTGGG - Intergenic
952548901 3:34453496-34453518 TTGAATCTATAGATTGCTTTGGG + Intergenic
952559222 3:34570293-34570315 TTGAATCTACAGGTCAATTTGGG + Intergenic
952635967 3:35531803-35531825 CTGAATCTACAGATCATTTTGGG - Intergenic
952703930 3:36357450-36357472 TTGAATCTATAGATCAAGTTGGG + Intergenic
952811255 3:37405448-37405470 TTGAATCTACAGACTGCTTTGGG + Intronic
953037083 3:39221814-39221836 TTGAATCTATAGATCAGTTTGGG - Intergenic
953110226 3:39929310-39929332 TTATATTTACATATCAATTTGGG - Intronic
953291706 3:41671158-41671180 TTGTATCTGTAGATTGCTTTGGG - Intronic
953422733 3:42767508-42767530 TTGAATCTATAGATCAAGTTGGG - Intronic
953501687 3:43442618-43442640 TTGAATCTATAGATCACTTTGGG - Intronic
953600102 3:44354478-44354500 TTGAATCTATAGATCAAGTTGGG + Intronic
953870550 3:46622931-46622953 TTGAATCTATAGGTCAATTTAGG + Intronic
954203138 3:49037260-49037282 TTGAATATACAGATTGATTCCGG - Intronic
954253409 3:49386141-49386163 CTGAATCTACAGATCGATTTGGG + Intronic
954483291 3:50822070-50822092 TTGAATCTGTAGATCGCTTTGGG + Intronic
954521694 3:51233190-51233212 TTGAATCTATAGATTGCTTTGGG + Intronic
954846090 3:53557919-53557941 CTGAATCTATAGATCGATTTGGG + Intronic
954891239 3:53931179-53931201 TTAAATCTGTAGATCGATTTGGG + Intergenic
954893066 3:53949437-53949459 GTTTATCTATAGATCAATTTGGG - Intergenic
955169990 3:56554272-56554294 TTGAATCTATAGATCAAGTTGGG + Intergenic
955210034 3:56932392-56932414 TTGTATATACAGTACAATTTGGG - Intronic
955249514 3:57265015-57265037 TTGAATCTATAGATTGCTTTGGG + Intronic
955667107 3:61361922-61361944 TTGAATCTGTAGATCAATTTGGG - Intergenic
956195075 3:66646316-66646338 TTGTATCTACATATTAATTTAGG - Intergenic
956912901 3:73838949-73838971 TTGAATCTGTAGATCGCTTTGGG - Intergenic
957013670 3:75037902-75037924 TTGAATCTACAGATTGCTTTGGG + Intergenic
957037200 3:75304929-75304951 TTGAATCTACAGATCAATTTGGG + Intergenic
957175242 3:76799792-76799814 TTGAATCTATAGATTGTTTTGGG - Intronic
957455161 3:80432033-80432055 TTGAATCTATAAATCGCTTTGGG - Intergenic
957570500 3:81941736-81941758 TTGAATCTATAGATTGCTTTGGG + Intergenic
957723646 3:84036228-84036250 TTGAATCTACAGATTGCTTTGGG - Intergenic
957977486 3:87465822-87465844 TTGAATCTACAAATTGCTTTGGG - Intergenic
958001732 3:87759324-87759346 TTGAATCTATAGATCAAGTTGGG - Intergenic
958002942 3:87774177-87774199 TTGAATTTACAGATTGCTTTTGG + Intergenic
958581826 3:96035889-96035911 TTGCATCTATAGATCAAGTTGGG + Intergenic
959301598 3:104609162-104609184 TTGAATCTATAAATCGTTTTGGG - Intergenic
959347382 3:105215738-105215760 TTGAATCTATAGATTGCTTTGGG + Intergenic
959402212 3:105916613-105916635 TTGAATCTATAGATCACTTTGGG + Intergenic
959428802 3:106225756-106225778 TTGACTCTACAGATTAATTTGGG + Intergenic
959499935 3:107094949-107094971 TTGAATCTATAGATCAAGTTGGG - Intergenic
959561330 3:107786241-107786263 TTGAATCTGTAGATCAATTTGGG - Intronic
959646567 3:108709988-108710010 TTATATTTAGAGATCAATTTGGG - Intergenic
959666572 3:108929004-108929026 TTGAATCTACAGATCAACTTGGG + Intronic
959728822 3:109576791-109576813 TTGACTCTATAGATCAATTTGGG - Intergenic
959779108 3:110206624-110206646 TTGAATCTATAAATCGTTTTGGG - Intergenic
959956535 3:112244767-112244789 CTGTATCCACAGATGGAATTAGG + Intronic
960168298 3:114428909-114428931 ATGAATTTACAGATAGATTTGGG + Intronic
960220557 3:115103274-115103296 TTGAATCTATAGATCAATTTGGG - Intronic
960227073 3:115181041-115181063 TTGAATCTACAGATCAAGTCAGG - Intergenic
960261106 3:115569281-115569303 TTGAATCTATAGATAGCTTTGGG - Intergenic
960353669 3:116624307-116624329 TTGAATCTATAGATTGCTTTGGG + Intronic
960547321 3:118930806-118930828 CTGAATCTATAGATCAATTTAGG - Intronic
960754350 3:120993864-120993886 TTGAATGTACAGATGGCTTTGGG + Intronic
960760188 3:121064508-121064530 TTGAATCTATAGATCATTTTCGG + Intronic
960813589 3:121650244-121650266 TTGAATCTATAGATCATTTTAGG - Intronic
960822966 3:121753734-121753756 TTGAATCTACAGATAAAGTTGGG - Intergenic
960860909 3:122152812-122152834 TTGAATCTGCAGATCAATTTGGG + Intergenic
960889250 3:122429629-122429651 TTGAATCTATAGATCAAGTTGGG - Intronic
961725709 3:128927939-128927961 TTGAATCTATAGATTGATTTGGG - Intronic
961865032 3:129947623-129947645 TTGTATCTACCGTTTCATTTAGG + Intergenic
961914790 3:130362694-130362716 TTAAATCTACAGATCAATTTGGG + Intronic
962195202 3:133356396-133356418 TTGTATCTGTAGATTGCTTTTGG - Intronic
962326386 3:134436715-134436737 TTACATCTACAGATCAATTTGGG + Intergenic
962483771 3:135821767-135821789 TTGTATCTGTAGATTGCTTTGGG - Intergenic
962651438 3:137497709-137497731 TTGAATCTGCAGATTGCTTTGGG + Intergenic
962774049 3:138641811-138641833 ATGAATCTACAGATGGTTTTGGG + Intergenic
962825596 3:139097497-139097519 TTGAATCTATAGGTCCATTTGGG + Intronic
963077763 3:141363320-141363342 TGGTACCTGCAGATCAATTTTGG - Intronic
963406853 3:144876257-144876279 TTGAATCTACAGATCACTTTTGG + Intergenic
963436986 3:145283824-145283846 TTGAATCTGCAGATTGCTTTGGG + Intergenic
963455621 3:145542857-145542879 TTGTATCTATAGATTGCTTTGGG + Intergenic
963514073 3:146286295-146286317 TTGTATCTATAGATCAATTTGGG + Intergenic
964174837 3:153815128-153815150 TTAAATCTAAAGATCAATTTGGG - Intergenic
964460814 3:156925003-156925025 TTGAATCTATAGATCAATTTGGG + Exonic
964462216 3:156946017-156946039 TTGTATCTGTAGATTGCTTTGGG + Intronic
964492739 3:157254129-157254151 TTGAATCTACAAATTGCTTTGGG + Intergenic
964759192 3:160117402-160117424 TTGAATCTACAGATTGCTTTGGG - Intergenic
964929860 3:162004068-162004090 TTGAATCTATAGATAGCTTTGGG + Intergenic
965026514 3:163308936-163308958 TTGAATCTATACATCGCTTTGGG - Intergenic
965035861 3:163437008-163437030 TTGACTCTACAGATTGCTTTGGG - Intergenic
965266295 3:166547841-166547863 TTGTATCTGCAGATAGTTTTGGG + Intergenic
965447181 3:168789438-168789460 TTGAATCTGCAGATTAATTTGGG - Intergenic
966016753 3:175149016-175149038 TTGAATCTATAGATTGCTTTGGG + Intronic
966296127 3:178425849-178425871 TTGAATCTGTAGATTGATTTGGG + Intronic
966652577 3:182317465-182317487 TTGAATCTATAAATCGCTTTGGG + Intergenic
966844279 3:184115168-184115190 TTGAATCTGTAGATCAATTTGGG - Intergenic
966964369 3:184975124-184975146 TTGAATCTACACATTGCTTTGGG + Intronic
967000958 3:185334238-185334260 TTAGATCTACAGACTGATTTAGG - Intronic
967196922 3:187035326-187035348 TTGAATCTACAGATTGCTTTGGG - Intronic
967354313 3:188550950-188550972 TTGTTTCTACAGAAGGAGTTTGG + Intronic
967454034 3:189660629-189660651 TTGAATCTGTAGATTGATTTGGG + Intronic
967461209 3:189748613-189748635 TTGAATCTATAGATTGCTTTGGG - Intronic
967531353 3:190552105-190552127 TTGTAACTAAAGTTTGATTTTGG + Intronic
967560614 3:190914206-190914228 TTGAATCTATAGATCGCGTTTGG + Intergenic
967944336 3:194791085-194791107 TTGAATCTGTAGATCGCTTTGGG + Intergenic
968732723 4:2277759-2277781 TTGAATCTGTAGATCGATTTGGG - Intronic
968840250 4:2998784-2998806 TTGAATCTATAGATCAATTTGGG - Intronic
968842637 4:3018966-3018988 TTTAATCTACAGATCAATTAGGG - Intronic
969062194 4:4445756-4445778 TTGAATTTATAGATCAATTTGGG - Intronic
969242547 4:5910071-5910093 TTGAATCTGTAGATCGCTTTGGG + Intronic
969553558 4:7889945-7889967 TTGCATCTATAGATGGATTTGGG - Intronic
969625164 4:8299051-8299073 TTGAATTTACAGATCAATTTGGG + Intronic
969942186 4:10744430-10744452 TTGAATCTGTAGATCAATTTTGG - Intergenic
970107381 4:12600034-12600056 TTGAATCTACAAATTGCTTTGGG - Intergenic
970534470 4:17015799-17015821 TTGAATCTACAGATCAATATGGG + Intergenic
970577438 4:17441460-17441482 TTGAATCTATAGATTGCTTTGGG - Intergenic
970818338 4:20184586-20184608 TTGAATTTACAGATTGTTTTTGG - Intergenic
971260097 4:25048745-25048767 TTGAATCTGTAGATCGCTTTGGG + Intergenic
971432844 4:26586528-26586550 TTGAATCTGTAGATCAATTTGGG + Intronic
971491867 4:27220962-27220984 TTGAATCTATAGATCACTTTGGG + Intergenic
971526004 4:27620038-27620060 TTGAATCTATAGATCAATTTGGG - Intergenic
971565037 4:28128199-28128221 TTGTTTCTATAAATCAATTTTGG - Intergenic
971804979 4:31345503-31345525 TTGAATCTATAGATCAATTAGGG - Intergenic
972040840 4:34596017-34596039 TTGAATCTATAGATTGCTTTGGG + Intergenic
972806336 4:42532576-42532598 TTGAATCTATAGATTGCTTTGGG - Intronic
972830089 4:42804522-42804544 TTGAATCTACAGATCAAATTGGG + Intergenic
972854027 4:43083950-43083972 TTGAATCTACAGATTGCTTTGGG + Intergenic
972920060 4:43927823-43927845 TTGAACCTAGAGATCAATTTGGG - Intergenic
972970164 4:44564994-44565016 TTGTATCTATAAATTGCTTTGGG - Intergenic
972976179 4:44639259-44639281 TTGAATCTATAGATTGCTTTGGG + Intronic
972997522 4:44899609-44899631 TTGAATCTGTAGATCAATTTGGG + Intergenic
973269420 4:48246349-48246371 TTGAATCTGTAGATCCATTTGGG - Intronic
973345853 4:49054574-49054596 TTGAATCTGCAGATTGCTTTTGG + Intronic
973906134 4:55533045-55533067 TTGAATCTATAGATTGCTTTAGG - Intronic
973911336 4:55583974-55583996 TGGAATCTACAGATTGCTTTGGG + Intronic
973986358 4:56357914-56357936 TTTAATTTACAGATCAATTTGGG + Intronic
974001500 4:56515869-56515891 TTGTATCTAAACGTCAATTTGGG - Intronic
974082393 4:57225884-57225906 CTGAATCTACAGATTGTTTTGGG + Intergenic
974104174 4:57449171-57449193 TTGAATCTGCAGATCACTTTGGG + Intergenic
974180063 4:58372910-58372932 TTGGATCTGCAGATTGTTTTAGG + Intergenic
974248612 4:59356339-59356361 TTGAATCTACAGATTGCTTTGGG + Intergenic
974277712 4:59747409-59747431 TTGAATCTGCAGATTGCTTTGGG - Intergenic
974475012 4:62367291-62367313 TTGAATCTACAGATCAAATTGGG - Intergenic
974655779 4:64819137-64819159 TTGAATCTACAGATCAATCTGGG + Intergenic
974712250 4:65613441-65613463 TTGAATCTGCAGATTGCTTTGGG + Intronic
975249581 4:72162950-72162972 TTACATCTACAGATTGCTTTGGG + Intergenic
975337110 4:73190986-73191008 TTGAATTTACAGATTAATTTGGG - Intronic
975371708 4:73596549-73596571 TTGAATCTACAAATTGCTTTGGG - Intronic
975672133 4:76790972-76790994 TTGAATCTATAGATAGCTTTTGG - Intergenic
975688436 4:76941732-76941754 TTGAATCTGTAGATCAATTTAGG + Intergenic
975996024 4:80316652-80316674 TTGAATCTATAAATCAATTTGGG - Intronic
976093197 4:81478518-81478540 TTGAATCTATAAATTGATTTGGG - Intronic
976136394 4:81941671-81941693 TTGAATCTATAGATCAGTTTGGG - Intronic
976161576 4:82206337-82206359 CTGAATCTACAGATTGCTTTGGG - Intergenic
976355591 4:84113506-84113528 TTGGATCCACAGATTGGTTTGGG + Intergenic
976368886 4:84263985-84264007 TTGAATCTATAGATTGATTTGGG - Intergenic
977015499 4:91687837-91687859 TTGAATCTATAGATTGCTTTGGG + Intergenic
977133853 4:93276500-93276522 TTGAATCTGTAGATCAATTTGGG + Intronic
977454478 4:97240730-97240752 TTGAATCTATAGATCAAGTTGGG - Intronic
977488726 4:97684169-97684191 TTGTATCTATAGATCAAATTGGG - Intronic
977872173 4:102105367-102105389 TTGTTTCTACAGTGCCATTTTGG - Intergenic
977953168 4:102997247-102997269 TTGAATCTATAGATTAATTTGGG + Intronic
978076428 4:104536489-104536511 TTGAATCAACAGATTGCTTTGGG + Intergenic
978156744 4:105498236-105498258 TTCAATCTATAGATCAATTTGGG - Intergenic
978213563 4:106169137-106169159 TTGAATCTACATATCAATTTGGG - Intronic
978948881 4:114532747-114532769 TTGAATATATAGATCAATTTGGG - Intergenic
979139067 4:117150145-117150167 TTGAATCTGCAGATTGATTTAGG + Intergenic
979165347 4:117522147-117522169 TTGAATCTGTAGATTGATTTGGG + Intergenic
979197290 4:117935176-117935198 TTGTATCTTTATATCAATTTTGG - Intergenic
979575322 4:122283877-122283899 TTGAATCTATAGATTTATTTGGG + Intronic
979723293 4:123929273-123929295 TTGGATTTCCAGATCAATTTAGG - Intergenic
979749906 4:124266370-124266392 TTGAATCTACAAATCAATTTGGG - Intergenic
980199571 4:129638570-129638592 TTGAATCTATAGATTGCTTTAGG + Intergenic
980244329 4:130219099-130219121 TTGAATCTATAGATTGCTTTTGG + Intergenic
980548101 4:134296103-134296125 TTGAATCTATAAATCGCTTTGGG - Intergenic
980584798 4:134797922-134797944 TTAAATCTACAGATCAAATTGGG - Intergenic
980658160 4:135816761-135816783 TTGAATCTACAGATTGGTTTGGG - Intergenic
981070618 4:140533146-140533168 TTGAATCCATAGATCGATTTGGG - Intronic
981105794 4:140879300-140879322 TTGAATTTACAGATTGCTTTGGG + Intronic
981396583 4:144256759-144256781 TTAGATCTACAGATCAATTTAGG + Intergenic
981868143 4:149452267-149452289 TTGAATCTGTAGATCAATTTGGG - Intergenic
981882962 4:149637710-149637732 TTATATATGCAGGTCGATTTAGG - Intergenic
981968687 4:150638013-150638035 TTGAATCTATAGATCAGTTTGGG + Intronic
982079442 4:151773681-151773703 TTGAATCTATAGATTAATTTGGG + Intergenic
982134499 4:152260535-152260557 TTGAATCTATAGATCAATTTGGG - Intergenic
982250855 4:153405063-153405085 TTGAATCTGTAGATCAATTTGGG - Intronic
982282611 4:153700501-153700523 TTGAATCTATAGAACAATTTGGG - Intergenic
982311675 4:153992349-153992371 TTGAATCTGCAGATTGCTTTGGG + Intergenic
982352506 4:154431131-154431153 TTGCATCTAAAGATCAGTTTAGG + Intronic
982491412 4:156034370-156034392 TTGAATCTATAGATCAAGTTGGG + Intergenic
982566053 4:156988226-156988248 TTAAATCTACAGATCAATTTGGG + Intergenic
982579163 4:157156166-157156188 TTGAATCTATAGATTGCTTTGGG + Intronic
982631577 4:157836625-157836647 TTACATCTACAGATTAATTTGGG - Intergenic
982682974 4:158454476-158454498 TTGAATCTGCAGATTGTTTTCGG + Intronic
982727763 4:158923320-158923342 TTGAATCTGTAGATCTATTTAGG + Intronic
983138885 4:164123381-164123403 TTGAATCTATAGATTGCTTTCGG - Intronic
983161059 4:164414863-164414885 TTGAATTTACAGGTCAATTTTGG - Intergenic
983164308 4:164456603-164456625 TTGAATCTTCAGATGGCTTTGGG - Intergenic
983173503 4:164561741-164561763 TTGAATCTATAGATAGCTTTGGG + Intergenic
983348487 4:166557819-166557841 TTGAATCTGCAGATTGCTTTGGG + Intergenic
983461723 4:168032639-168032661 TTGAATCTATAGATCAATTTAGG + Intergenic
983487342 4:168347767-168347789 TTGAATCTACAAATTGCTTTGGG + Intergenic
983571614 4:169214496-169214518 TTGAATCTATAGATCAAGTTGGG + Intronic
983731384 4:170998033-170998055 TGCTATCTACAGATTTATTTGGG + Intergenic
983750448 4:171261868-171261890 TTGAATCTGCAGATTGCTTTGGG + Intergenic
984003401 4:174279429-174279451 TTGAATCTATAGATCACTTTGGG - Intronic
984017895 4:174447490-174447512 TTGTTTATACAGATCCATTTTGG + Intergenic
984204160 4:176766202-176766224 TTGAATCTAAAAATTGATTTGGG - Intronic
984319799 4:178179346-178179368 TTGAATCTGCAGATCAATTTGGG - Intergenic
984627784 4:182027025-182027047 TTGAATCTATAGATTGCTTTGGG + Intergenic
985232644 4:187837794-187837816 TTGAATCTACAAATTGCTTTGGG + Intergenic
985352344 4:189078419-189078441 TTGAATCTATAGATCAATTTTGG - Intergenic
985516757 5:350180-350202 TTGAATCTATAGATCAGTTTTGG + Intronic
985527076 5:410585-410607 TTATATCTACAGATCAATTTAGG + Intronic
985728624 5:1529674-1529696 TTGAATCTATTGATCAATTTGGG + Intergenic
985759647 5:1739661-1739683 TTGAATCTACAGATCAATTTGGG + Intergenic
986356459 5:6932636-6932658 TTGAATCTAAAGATAAATTTGGG + Intergenic
986463814 5:8000603-8000625 TTGAATCTGCAGATTGCTTTGGG + Intergenic
986821184 5:11468523-11468545 CTGTATCTACAGAGAGATCTGGG - Intronic
987537983 5:19213054-19213076 TTGAATCTATAGATTGCTTTGGG - Intergenic
987551700 5:19390962-19390984 TTGAATCTACAGATTAATTAAGG - Intergenic
987689654 5:21250674-21250696 TTGAATCTACAGATCACTTTGGG + Intergenic
987696941 5:21344452-21344474 TTGAATCTACAAATTGCTTTGGG + Intergenic
987957359 5:24757738-24757760 TTGAATCTATAGATTGCTTTGGG + Intergenic
988007438 5:25435066-25435088 TTGAATCTATAGATCAAGTTGGG - Intergenic
988102383 5:26697648-26697670 TTGCATCTATAGATTGCTTTGGG - Intergenic
988647701 5:33112282-33112304 GTGAATCTACAGATCAAGTTGGG + Intergenic
988755263 5:34242088-34242110 TTGAATCTACAAATTGCTTTGGG - Intergenic
988935724 5:36080878-36080900 TTGAATCTAGACATCAATTTGGG + Intergenic
988937288 5:36097627-36097649 TTGAACCTATAGATCAATTTGGG + Intergenic
989008413 5:36841451-36841473 TTGAATCTATAGATTGCTTTGGG + Intergenic
989032439 5:37133341-37133363 TTGAATCTATAGATTGCTTTGGG + Intronic
989416829 5:41188204-41188226 TTGAATCTATAAATCAATTTGGG - Intronic
989420116 5:41228035-41228057 TTGAATCTGTAGATCGATTTTGG + Intronic
989545663 5:42669948-42669970 TTGAATCTATAGATTGCTTTGGG - Intronic
989629916 5:43471363-43471385 TTGAATCTATAGATTGCTTTGGG - Intronic
989955456 5:50354162-50354184 TTATATCTACAGATCAGTTTGGG + Intergenic
990096978 5:52128087-52128109 TTGAATCTATAGATCAAGTTGGG - Intergenic
990231784 5:53720532-53720554 TTGAATCTACAGATTACTTTGGG - Intergenic
990313147 5:54559147-54559169 TTGAATCTACAAATTGCTTTGGG - Intergenic
990326684 5:54683689-54683711 TTGAATCTACAGATCAAGTAAGG + Intergenic
990338351 5:54797090-54797112 TTGTATATACTGCTGGATTTTGG - Intergenic
991106351 5:62847207-62847229 TTGAATCTGTAGATTGATTTAGG + Intergenic
991205671 5:64047514-64047536 TTGAATCTATAGATTGCTTTGGG - Intergenic
991310768 5:65238862-65238884 TTGAATCTATAGATCAATTGAGG - Intronic
991692996 5:69243699-69243721 TTGAATCTATAGATTGCTTTAGG + Intronic
991938159 5:71823470-71823492 TTGAATCTGCAGATTGCTTTGGG + Intergenic
992011833 5:72535685-72535707 TTGAATCTATACATCAATTTGGG - Intergenic
992111159 5:73495548-73495570 TTGGTTGTATAGATCGATTTGGG - Intergenic
992132855 5:73711392-73711414 TTATATCTATAGATCAAATTGGG + Intronic
992161001 5:74001631-74001653 TTGAATCTATAGACCAATTTGGG + Intergenic
992257823 5:74939171-74939193 TTGAATCTATAGATTGCTTTGGG - Intergenic
992276644 5:75127697-75127719 CTGAATCTATAGATCAATTTGGG + Intronic
992344272 5:75860512-75860534 TTGAATCTATAGATAGCTTTGGG - Intergenic
992406751 5:76465950-76465972 TTGAATCTATAAATCAATTTGGG - Intronic
992485812 5:77193734-77193756 TTGAATCTATAGATCAATTTAGG + Intergenic
992824494 5:80535174-80535196 TTGAATCTACAGATTGCTTTAGG - Intronic
992957118 5:81921426-81921448 TTGAATCTATAGATTGCTTTTGG + Intergenic
993445627 5:88009015-88009037 TTATATCTACAGCTCAATTTAGG - Intergenic
993588747 5:89766757-89766779 TTGAATCTACAGATCAATGTGGG + Intergenic
993785610 5:92131189-92131211 TTGGATCTATAGATCAATTTGGG + Intergenic
993881892 5:93372806-93372828 TTGAATCTATAGATTGCTTTGGG - Intergenic
993944427 5:94100362-94100384 TTGAATCTATAGATTGCTTTGGG - Intronic
993972491 5:94436688-94436710 TTGTATCTATAAATTTATTTCGG + Intronic
994016890 5:94977395-94977417 TTGAATCTATAGATTGCTTTGGG - Intronic
994281246 5:97905466-97905488 TTGAATCTACAGATTGATTTGGG - Intergenic
994346117 5:98688839-98688861 TTGAATCTATAGATCACTTTGGG - Intergenic
994441062 5:99803294-99803316 TTGAATCTGCAGATCACTTTGGG - Intergenic
994617498 5:102123770-102123792 TTGAATCTATAGATCAAGTTGGG + Intergenic
994690507 5:103013135-103013157 TTGAATCTGCAGATTGCTTTGGG + Intronic
994795480 5:104293559-104293581 TTGTATCTATAAATTGCTTTGGG - Intergenic
994864564 5:105250227-105250249 TTGTATCTACAGATCACTTTGGG - Intergenic
994883362 5:105527005-105527027 TTGAATTTGCAGATTGATTTTGG + Intergenic
995567431 5:113445665-113445687 TTGAATCTGTAGATCGCTTTGGG - Intronic
995691978 5:114837222-114837244 TTGAATCTATAGATTGCTTTTGG - Intergenic
995745715 5:115400772-115400794 TTGAATCTATAGATCACTTTGGG + Intergenic
996004843 5:118407199-118407221 TTGAATCTATAGATTGCTTTGGG + Intergenic
996218886 5:120903814-120903836 TTGAATCTATAGATTGCTTTGGG + Intergenic
996345402 5:122483296-122483318 TTGAAGTTACAGATCAATTTGGG - Intergenic
996659494 5:125984045-125984067 TTGAATCTATAGATTGCTTTCGG + Intergenic
996684157 5:126262231-126262253 TTGTATCTGTAGATTGCTTTGGG - Intergenic
996778931 5:127161914-127161936 TTGAATCTATAGATCAAGTTGGG + Intergenic
996803003 5:127424436-127424458 TTGAATCTATAGATCAATTTGGG + Intronic
996969878 5:129353071-129353093 TTGAATCTATAGATAGCTTTGGG - Intergenic
997017268 5:129950826-129950848 CTGAATCTGCAGATCGCTTTGGG - Intronic
997079272 5:130718788-130718810 TTGAATCTATAGATTGCTTTGGG - Intergenic
997156729 5:131569149-131569171 TTGAATCTATAGATTAATTTGGG - Intronic
997204680 5:132039274-132039296 TTGAATCTATAGATTGCTTTAGG + Intergenic
997314238 5:132918803-132918825 TTGGATCTATAGATCAATTTGGG - Intronic
997608934 5:135197479-135197501 TTGAATCTATAGATTGCTTTGGG + Intronic
997707383 5:135969665-135969687 TTGAATCTGTAGATCAATTTAGG + Intergenic
997784036 5:136690476-136690498 TTGAATCTACAGATTGCTTTGGG - Intergenic
998012444 5:138706102-138706124 TTGAATCTGTAGATCGATTCTGG - Intronic
998356556 5:141541962-141541984 TTGAATCTGTAGATCGATTTGGG - Intronic
999028710 5:148265350-148265372 TTGCATCTGTAGATTGATTTGGG - Intergenic
999315558 5:150581615-150581637 TTGAATCTGTAGATCAATTTTGG - Intergenic
999573855 5:152951716-152951738 TTGAATCTATAGATCACTTTGGG - Intergenic
1000061528 5:157660872-157660894 TTGAATCTATGGATCAATTTTGG + Intronic
1000066915 5:157701311-157701333 TTGAATCTATGGATCAATTTTGG + Intergenic
1000566958 5:162860245-162860267 TTGAATCTATAGGTCAATTTGGG - Intergenic
1000839440 5:166198406-166198428 TTGAATTTACAGATCAATTTGGG + Intergenic
1000859687 5:166441248-166441270 TTGAATCTGTAGATCAATTTGGG + Intergenic
1000913824 5:167055474-167055496 TTGAATCTATAGATCAAGTTGGG + Intergenic
1001457896 5:171880496-171880518 TTGAACCTACAGACCAATTTGGG + Intronic
1001462630 5:171931098-171931120 TTGAATCTATAGATCCAGTTGGG - Intronic
1001538518 5:172519030-172519052 TTGAATCTATAGATCGAATTGGG - Intergenic
1001736886 5:174012645-174012667 TTGAATCTATAGATCAGTTTGGG + Intergenic
1002002486 5:176205562-176205584 TGGAATCTACAGATTAATTTGGG + Intergenic
1002003563 5:176213907-176213929 TTGAAGCTATAGATCAATTTGGG - Intergenic
1002222894 5:177697009-177697031 TTGAAGCTATAGATCAATTTGGG + Intergenic
1002615276 5:180449662-180449684 TTAAATCTATAGATCAATTTGGG - Intergenic
1002631709 5:180585845-180585867 TTGAATCTGTAGATCAATTTAGG - Intergenic
1002767032 6:250301-250323 TTGAATCTGTAGATCAATTTGGG + Intergenic
1002844054 6:930386-930408 TTGAACCTGCAGATCAATTTGGG - Intergenic
1003262853 6:4537859-4537881 TTGAATCTGCAGATCAATTTGGG - Intergenic
1003300583 6:4877895-4877917 TTGTATCTATAGATGCATTTGGG + Intronic
1003483978 6:6559059-6559081 TTAAAACTACAGATCAATTTAGG + Intergenic
1004033418 6:11896287-11896309 TTGAATCTATAGATCAAGTTGGG + Intergenic
1004353798 6:14913989-14914011 TTAAATCTACAGATCACTTTGGG - Intergenic
1004435349 6:15587321-15587343 TTGCATGTATAGATCAATTTGGG - Intronic
1004742129 6:18472329-18472351 TTATATCAACACATTGATTTTGG + Intergenic
1004792836 6:19046958-19046980 TTGAATCTATATATCAATTTGGG + Intergenic
1004813337 6:19284926-19284948 TTGAATCTATAGATTGCTTTGGG - Intergenic
1004910982 6:20283603-20283625 TTGAATCTATAGATTGCTTTGGG - Intergenic
1005007532 6:21303935-21303957 TTGAATCTATAGATCAACTTAGG - Intergenic
1005089329 6:22040155-22040177 TTGAATCTACAGATTGCTTTGGG + Intergenic
1005100287 6:22165347-22165369 TTGAATCTATAGATCACTTTAGG + Intergenic
1005265045 6:24102963-24102985 TTGTTTCAACAGATCCAGTTTGG + Intergenic
1005362898 6:25048584-25048606 TTGTATCTGCAGATTGCTTTGGG - Intergenic
1005424460 6:25687254-25687276 TTGAATCTGCAGATCAATTTGGG + Intronic
1005553895 6:26953853-26953875 TTGAATCTACAAATTGCTTTGGG - Intergenic
1005607296 6:27487422-27487444 TTGAATCTATTGATCAATTTAGG - Intergenic
1005658100 6:27964728-27964750 TTGGATCTATAGATCAATTTGGG + Intergenic
1005658685 6:27970410-27970432 TTGAATCTATAGATTGCTTTGGG - Intergenic
1005708675 6:28482295-28482317 TTGTATCTATAGATCAAATTGGG - Intergenic
1006431123 6:33996557-33996579 TTGAATCTACAGATCATTTTGGG - Intergenic
1006666306 6:35696627-35696649 TTATATCAAAAGATCAATTTGGG - Intronic
1006952993 6:37840644-37840666 TTGCATCTCCAGATGAATTTGGG + Intronic
1007140078 6:39563461-39563483 ATGTATCTACATATTGATCTGGG - Intronic
1007190279 6:40009863-40009885 TTGAATCTGTAGATCGATTTGGG + Intergenic
1007920389 6:45604033-45604055 TTGAATCTACAGATAAATTTGGG - Intronic
1008258714 6:49337887-49337909 TTGAATCTACAGATCAGTTTGGG - Intergenic
1008386624 6:50898339-50898361 TTAAATCTGTAGATCGATTTGGG + Intergenic
1008409918 6:51164815-51164837 TTGAATCTGTAGATAGATTTGGG + Intergenic
1008551285 6:52633935-52633957 TTGAATCTACAGGCCAATTTTGG - Intergenic
1008681034 6:53872697-53872719 TTGAATCTATAGATTGCTTTGGG + Intronic
1008737517 6:54563855-54563877 TTGAATCTACAAATTGCTTTGGG - Intergenic
1009206447 6:60807496-60807518 TTGAATCTATAGATTGCTTTGGG + Intergenic
1009879627 6:69549951-69549973 TTCAATCTACAGATCAATTTGGG + Intergenic
1010035052 6:71315626-71315648 TTGAATCTAAAGATCAATTTGGG - Intergenic
1010040173 6:71372449-71372471 CTGAATCTACAGATCAACTTGGG + Intergenic
1010219310 6:73433900-73433922 TTGAATCTATAGATAAATTTGGG - Intronic
1010381244 6:75227527-75227549 TTGAATCTATAGATTGCTTTGGG - Intergenic
1010557605 6:77303390-77303412 TTGAATCTGTAGATCGCTTTGGG + Intergenic
1010679973 6:78787439-78787461 TTGGATATACAGATTAATTTGGG - Intergenic
1010726742 6:79343708-79343730 TTGAATCTATAGATAGCTTTGGG - Intergenic
1011017854 6:82778612-82778634 TTGAATCTACAGAGCAATTTGGG - Intergenic
1011092883 6:83626425-83626447 TTGAATCTACGGATTGCTTTGGG + Intronic
1011176137 6:84562636-84562658 TTGAATCTATAGATTGCTTTGGG - Intergenic
1011229997 6:85150078-85150100 TTGAATCTATAGATCACTTTGGG + Intergenic
1011238639 6:85246479-85246501 TTGAATCTATAGACCAATTTGGG - Intergenic
1011505109 6:88033238-88033260 TTGAATCTACAGATCAAGTTGGG + Intergenic
1011589481 6:88957804-88957826 TTGAATCTAAAGATTGCTTTTGG - Intronic
1011592132 6:88980248-88980270 TTGAATCTATAGATTGCTTTGGG + Intergenic
1012202791 6:96426565-96426587 TTGAATCTATAGATTGCTTTGGG + Intergenic
1012293417 6:97488563-97488585 TTGCATCTACAGATCACGTTGGG + Intergenic
1012397536 6:98817034-98817056 TTGAATCTACCTATCAATTTGGG - Intergenic
1012489675 6:99767902-99767924 TTAAATCTATAGATCAATTTGGG + Intergenic
1012580136 6:100857935-100857957 CTGAATCTACAGATCAATTTGGG + Intronic
1013092779 6:106915655-106915677 TTGAATCTATAGATCCATTTGGG - Intergenic
1013306956 6:108857135-108857157 TTGAATCTATAGATCAAGTTGGG + Intronic
1013440679 6:110163657-110163679 TTGAATCTACAGATCAAGTTGGG - Intronic
1013741734 6:113295377-113295399 TTGAATCTATAAATCGCTTTGGG - Intergenic
1013939258 6:115642031-115642053 TTGACTCTACAGATCTATTAGGG - Intergenic
1013943996 6:115700802-115700824 TTGAATCTGCAGATCACTTTGGG + Intergenic
1014118951 6:117701142-117701164 TTGAATCTATAGCTCAATTTGGG + Intronic
1014226490 6:118853824-118853846 GTGATTCTACAGATCGCTTTGGG + Intronic
1014330544 6:120058681-120058703 TTGAATCTATAGATTGCTTTGGG - Intergenic
1014334219 6:120111997-120112019 TTCAATCTATAGATTGATTTGGG - Intergenic
1014558942 6:122867271-122867293 TTAAATCTATAGATCAATTTGGG + Intergenic
1015101249 6:129483566-129483588 TTGAATCTACATATCATTTTGGG - Intronic
1015301945 6:131662754-131662776 TTGAATCTATAGATTGTTTTGGG + Intronic
1015349894 6:132205655-132205677 TTGAATCTATAGATTGCTTTGGG + Intergenic
1015565945 6:134571441-134571463 TTGAATCTGCAGATTGCTTTTGG - Intergenic
1015647788 6:135413919-135413941 TTGAATCTACAGATCATTTGGGG - Intronic
1015800393 6:137055369-137055391 TTGAATCTGTAGATCAATTTGGG - Intergenic
1015887762 6:137936560-137936582 TTGAATCTATAGATCACTTTGGG + Intergenic
1016221228 6:141672372-141672394 TTGAATCTGAAGATTGATTTGGG - Intergenic
1016341821 6:143070238-143070260 TTGAATCTATAAAACGATTTGGG + Intronic
1016612363 6:146005506-146005528 TTGAATCTGTAGATTGATTTGGG - Intergenic
1016762625 6:147755126-147755148 TTGAATCTATAGATTGCTTTGGG + Intergenic
1016904658 6:149136908-149136930 TTGTATCAACATATAAATTTGGG + Intergenic
1016994178 6:149949459-149949481 TTGCATCTATAAATCGCTTTTGG - Intergenic
1017548393 6:155476924-155476946 TTGAATCTAAAGACTGATTTGGG - Intergenic
1017580762 6:155862510-155862532 TTGAATCTATAAATTGATTTGGG + Intergenic
1017597176 6:156042160-156042182 TTGATTGTACAGATCAATTTCGG - Intergenic
1017610494 6:156181050-156181072 TTGAATCTATAGATCACTTTGGG + Intergenic
1018597822 6:165501728-165501750 TTTACTCTACAGATCAATTTGGG - Intronic
1018789246 6:167133671-167133693 TTGTATCTACAGATCGATTTGGG + Intronic
1018863282 6:167728134-167728156 TTAAATCTACAGATCAAGTTGGG - Intergenic
1019295919 7:274871-274893 TTTTATGAACAGATGGATTTTGG - Intergenic
1019836829 7:3394587-3394609 TTGAATGTATAGATCAATTTGGG + Intronic
1020404829 7:7820326-7820348 TTGTATCTCAAGATCTTTTTAGG + Intronic
1020652898 7:10896381-10896403 TTGAATCTATAGATTGCTTTGGG - Intergenic
1020662716 7:11001461-11001483 TTGAATCTATAGATCAAGTTGGG + Intronic
1020760733 7:12265602-12265624 TTGAATCTATAGACCAATTTAGG + Intergenic
1020874433 7:13675283-13675305 TTGAATCTATAGATTGGTTTGGG - Intergenic
1021189079 7:17599853-17599875 TGCTATCTACAGGTCGGTTTAGG + Intergenic
1021211457 7:17858561-17858583 TTGAATCTATAGATGAATTTAGG - Intronic
1021336913 7:19414621-19414643 TTGGATCCACAGATTGAATTAGG + Intergenic
1021381646 7:19974656-19974678 TTGTATCTATATATCAAGTTAGG + Intergenic
1021437708 7:20639918-20639940 TTGAATCTATAGATAAATTTGGG + Intronic
1021605808 7:22408379-22408401 TTGAATCTATAGATTGCTTTGGG - Intergenic
1022016630 7:26355389-26355411 TTAAACCTACAGATCAATTTGGG + Intronic
1022075117 7:26961099-26961121 TTGAATCTATAGATCAAGTTTGG - Intronic
1022135679 7:27446107-27446129 TTGAATCTGCAGATCAATTTGGG + Intergenic
1022742424 7:33135746-33135768 TTGAATCTGTAGATTGATTTGGG + Intronic
1022759443 7:33331876-33331898 TTGAATCTATAGATTGCTTTGGG - Intronic
1023149365 7:37185891-37185913 TTGAATCTGTAGATCAATTTAGG - Intronic
1023240241 7:38137403-38137425 TTGGATCTACAGAGTAATTTGGG - Intergenic
1023270718 7:38459272-38459294 TTGTATCTGTAGATTGCTTTGGG - Intronic
1023553570 7:41395553-41395575 TTGAACCTATAGATCAATTTTGG + Intergenic
1023649472 7:42353851-42353873 TTGAATCTACAGATCAATTTGGG - Intergenic
1023811096 7:43912634-43912656 TTGTATCTGCAGATCACTTGGGG + Intronic
1024023708 7:45393165-45393187 TTAAATCTATAGATCAATTTGGG + Intergenic
1024190783 7:47006786-47006808 TTGAATCTATAGGTCGAGTTGGG - Intergenic
1024351125 7:48365922-48365944 TTGGATCTGCAGATTGTTTTGGG - Intronic
1024405378 7:48973345-48973367 TTGAATCTACATATTGCTTTGGG - Intergenic
1024411186 7:49044093-49044115 TTGTATCTGTAGATTGCTTTGGG - Intergenic
1024451906 7:49556762-49556784 TTGAATCTGTAGATTGATTTGGG - Intergenic
1024467380 7:49726473-49726495 TTGCATCTATAGATCAATTTAGG + Intergenic
1024690110 7:51791551-51791573 TTGAATCTATAGATCAAATTGGG - Intergenic
1024763138 7:52625125-52625147 TTGAATCTATAGATTGCTTTGGG + Intergenic
1024794044 7:53002087-53002109 TTGTATGTACAAATCAATTTTGG - Intergenic
1024893986 7:54235592-54235614 TTGAATCTATAGATTGCTTTGGG - Intergenic
1026021637 7:66712155-66712177 TTAAATCTACAGATCACTTTGGG + Intronic
1026208922 7:68285299-68285321 TTGAATCTATAGATTGCTTTGGG - Intergenic
1026485842 7:70819988-70820010 TTGGATCTATAGATCTGTTTGGG - Intergenic
1026591976 7:71704438-71704460 TTGAATCTCTAGATCAATTTAGG - Intronic
1026886043 7:73946700-73946722 TTAAATCTACAGATCAGTTTGGG + Intergenic
1027334740 7:77137671-77137693 TTGAATCTACAGATCAATTTGGG - Intronic
1027582003 7:80009171-80009193 TTGAATCTACAGATTAAGTTTGG - Intergenic
1027826487 7:83123056-83123078 TTGTATCTGTAGATTGCTTTGGG - Intronic
1028026957 7:85855274-85855296 TTGCATCTACAGATAATTTTGGG + Intergenic
1028033231 7:85945404-85945426 TTGAATCTACAGTTTGCTTTGGG + Intergenic
1028036829 7:85994534-85994556 TTGAATCTGCAGATTGCTTTGGG + Intergenic
1028344666 7:89764511-89764533 TTGAATCTGTAGATCAATTTGGG - Intergenic
1028358362 7:89937094-89937116 TTGAATCTATAGATCAATGTGGG + Intergenic
1028643103 7:93065929-93065951 TTGTATCTGTAGATTGCTTTGGG + Intergenic
1028748765 7:94358172-94358194 TTGAATCTATAGATTGTTTTGGG - Intergenic
1028763568 7:94523632-94523654 CTGAACCTACAGATCGGTTTGGG - Intronic
1028815359 7:95137632-95137654 TTGACTCTACAGATCAATATGGG - Intronic
1028911693 7:96214976-96214998 TTGAATCTATAGATCATTTTAGG - Intronic
1029038254 7:97545881-97545903 TTAAATCTACAGATCAATTTGGG - Intergenic
1029781061 7:102733431-102733453 TTGAATCTACAGATCAATTTGGG + Intergenic
1029916709 7:104217508-104217530 TTGAATCTACACATCAATTTGGG - Intergenic
1030155064 7:106446588-106446610 TTGTATCTATAAATCAATTTTGG + Intergenic
1030224608 7:107135794-107135816 TTGAATCTACAGATCAACTTGGG - Intronic
1030625219 7:111838126-111838148 TTGAATCTATATATCGATTTGGG - Intronic
1030640182 7:111996199-111996221 TTGTGTCTTCAGATCAATGTAGG - Intronic
1030679235 7:112417082-112417104 TTGAATCTGTAGATCGCTTTGGG - Intergenic
1030790424 7:113720403-113720425 TTGAATCTACAGATCAAGTTTGG - Intergenic
1030794164 7:113767038-113767060 TTGAATCTATAGATCACTTTGGG + Intergenic
1030850321 7:114476686-114476708 TTGAATCTATAGATTGGTTTGGG + Intronic
1031112944 7:117633081-117633103 TTGAATCTATAGATGGAGTTGGG + Intronic
1031160678 7:118164096-118164118 CTGAATCTACAGATTAATTTAGG + Intergenic
1031190509 7:118543739-118543761 TTGAATCTATAGATTGCTTTGGG - Intergenic
1031354386 7:120772991-120773013 TTGAACCTAAAGATCAATTTGGG + Intergenic
1031430346 7:121660645-121660667 TTCTATCTATAGATCGAGCTGGG + Intergenic
1031773403 7:125874884-125874906 TTGAATCTACAAATCAATTTTGG + Intergenic
1032288229 7:130560410-130560432 TTGAATCTATAAATCAATTTGGG - Intronic
1032769906 7:135041194-135041216 TTAAATCTACAGATCAACTTGGG - Intronic
1032774579 7:135098103-135098125 TTGTATCTGTAGACCTATTTTGG - Intronic
1032892561 7:136214724-136214746 TTGTATCTACAGGAGTATTTTGG + Intergenic
1033060494 7:138101847-138101869 TTGAATCTACAGATGAATTTGGG - Intronic
1033100580 7:138467293-138467315 TTGAATCTAGATATCAATTTGGG + Intronic
1033797591 7:144865906-144865928 TTGGATCTGTAGATCAATTTGGG + Intergenic
1034031462 7:147770777-147770799 TTTACTCTACAGATCAATTTTGG - Intronic
1034126971 7:148681830-148681852 TTGAATCTGCAGGTCGCTTTGGG - Intergenic
1034172961 7:149077262-149077284 TTGAATCTATAGATTCATTTGGG + Intronic
1034320421 7:150174922-150174944 TTGAATCTACTGATCAATTTGGG - Intergenic
1034354370 7:150440973-150440995 TTGAATGTATAGATCAATTTTGG + Intergenic
1034524242 7:151646252-151646274 TTTGATCTACAGATCAATTTGGG + Intronic
1034892035 7:154849244-154849266 TTGAATCTACAAATCACTTTTGG + Intronic
1035646848 8:1230434-1230456 TTGAATCTGTAGATCGCTTTGGG - Intergenic
1035742805 8:1941531-1941553 TTGAATCTGCAGATCCAATTGGG - Intronic
1036103382 8:5812676-5812698 TTGTATCTACAGGCTGGTTTTGG - Intergenic
1036110381 8:5893337-5893359 TTGAATCTGTAGATTGATTTGGG - Intergenic
1036162696 8:6404602-6404624 TTGACTCTACAGATGAATTTGGG - Intergenic
1037105366 8:15100524-15100546 TTGAATCTACAGATAAAGTTGGG - Intronic
1037125969 8:15350074-15350096 TTGAATCTACAGATTATTTTGGG - Intergenic
1037140364 8:15511940-15511962 TTGAATCTATAGATAAATTTAGG - Intronic
1037244606 8:16818704-16818726 TTGGATCTGTAGATCCATTTGGG - Intergenic
1037912418 8:22751673-22751695 TTGTATTTACAGAACATTTTGGG + Intronic
1037979829 8:23244704-23244726 CTGGATCTACAGATCAATTTGGG + Intronic
1038128539 8:24702212-24702234 TTGGATCTGTTGATCGATTTTGG - Intergenic
1038232148 8:25711351-25711373 TTGAATCCACAGTTCAATTTGGG + Intergenic
1038273009 8:26091785-26091807 TTGAATCTACAGATCAAGTTGGG - Intergenic
1038403266 8:27302207-27302229 TTGTCTCTATAGATCAATTTGGG + Intronic
1038562580 8:28593332-28593354 TTGCATCTACAGATTGCTTTTGG + Intergenic
1038708313 8:29917642-29917664 TTGAATCTATAGATTGCTTTGGG - Intergenic
1038730545 8:30122828-30122850 TTGAAGCTATAGATCAATTTGGG + Intronic
1038789119 8:30651660-30651682 TTGAATCTATAAATCAATTTGGG - Intronic
1038809026 8:30821173-30821195 TTAAATCTATAGATTGATTTGGG + Intergenic
1038873727 8:31524336-31524358 TTGTATCTATAGATAAATTTAGG + Intergenic
1039358776 8:36851144-36851166 TTGAATCTATAGATAAATTTTGG + Intronic
1039625411 8:39046037-39046059 TTGAATCTGCAGATCACTTTGGG + Intronic
1039638832 8:39195908-39195930 TTGGATCTGTAGATCGCTTTGGG + Intronic
1039666074 8:39529789-39529811 CTGAATCTACAGATCAATTTGGG - Intergenic
1039805820 8:40997139-40997161 TTGAATCTGTAGATCAATTTAGG + Intergenic
1040475235 8:47770711-47770733 TTGAATCTGCAGATTGCTTTGGG - Intergenic
1040525516 8:48220540-48220562 TTGAATCTACAGGTCAATTTCGG - Intergenic
1040672599 8:49710715-49710737 TTGAATCTACAAATTGCTTTGGG - Intergenic
1040970141 8:53126920-53126942 TTGAATCTATAGATTGCTTTTGG + Intergenic
1040994239 8:53385806-53385828 TTGAATCTATAAATCAATTTAGG + Intergenic
1041012075 8:53554362-53554384 TTGAATCTATAGATCAGTTTAGG - Intergenic
1041791978 8:61706581-61706603 TTGAATCTATAGAACAATTTGGG - Intronic
1042074304 8:64973169-64973191 TTGAATCTGCAGATCATTTTGGG + Intergenic
1042366657 8:67944941-67944963 TTGAATCTATAGATCAAATTGGG - Intergenic
1042371594 8:67997682-67997704 GTGAATCTATAGATCAATTTTGG + Intronic
1042433722 8:68739664-68739686 TTGAATCTACAAATTGCTTTGGG - Intronic
1042461815 8:69078550-69078572 TTGTATCTCCATCTCGTTTTGGG - Intergenic
1042474277 8:69228601-69228623 TTGAATCTATAGATCAATTTGGG - Intergenic
1042538486 8:69883441-69883463 TTGAATCTAAAGATCAATTTGGG - Intergenic
1042631113 8:70817550-70817572 TTGAATCTATAGATTGCTTTGGG - Intergenic
1042974351 8:74449396-74449418 TTGAATTTATAGATCAATTTGGG + Intronic
1043145801 8:76652589-76652611 TTGTATCTTTAGAATGATTTAGG + Intergenic
1043280396 8:78458178-78458200 TTGAATCTGCAGATATATTTGGG - Intergenic
1043541941 8:81273864-81273886 TTGAATCTACAGATCACTTTGGG + Intergenic
1043654733 8:82648674-82648696 TTGCATCTGCAGATTGCTTTGGG - Intergenic
1043806152 8:84673945-84673967 TTGAATCTACAAATTGCTTTGGG + Intronic
1044010714 8:86990758-86990780 TTGAATCTATAGATTGCTTTAGG + Intronic
1044185617 8:89247446-89247468 TTGAATCTACAGATTGCTTTGGG + Intergenic
1044242929 8:89907825-89907847 TTGTATCTATAAATTGCTTTGGG + Intronic
1044249184 8:89986486-89986508 TTGAATCTATAGAACAATTTTGG - Intronic
1044272245 8:90259909-90259931 TTGAATCTACAAATTGCTTTGGG - Intergenic
1044376369 8:91477441-91477463 TTAGATCTGCAGATCAATTTGGG - Intergenic
1044411686 8:91891263-91891285 TTGAATCTGTAGATCAATTTAGG - Intergenic
1044552532 8:93528156-93528178 TTGAATCTATAGATTGCTTTGGG + Intergenic
1044998923 8:97863344-97863366 TTGAATCTGTAGATCAATTTGGG + Intergenic
1045119312 8:99017878-99017900 TTGAATCTATCGATCAATTTTGG + Intronic
1045400762 8:101815042-101815064 TTGAATCTATAGATCAAGTTAGG - Intronic
1045600040 8:103703561-103703583 TTGAATCTATAGATTGCTTTTGG + Intronic
1045698916 8:104843271-104843293 TTGAATCTACAGATTACTTTTGG + Intronic
1046024112 8:108701828-108701850 TTGAATCTATAGATCAATTTGGG - Intronic
1046040557 8:108898453-108898475 TTGAATCTATAGATCACTTTAGG - Intergenic
1046113611 8:109757647-109757669 TTGAATCTATAGATCAAATTGGG + Intergenic
1046156945 8:110304581-110304603 TTGAATCTACAAATGGCTTTGGG - Intergenic
1046233065 8:111383064-111383086 TTGAATCTATAGATTGCTTTGGG + Intergenic
1046388669 8:113538783-113538805 TTGAATCTACAGATCAAGTTAGG + Intergenic
1046394263 8:113619768-113619790 TTGAATCTGTAGATAGATTTAGG - Intergenic
1046429456 8:114105782-114105804 TTGTATCTAAAAATAAATTTGGG - Intergenic
1046434822 8:114173973-114173995 TTGAATCTATAGATGAATTTGGG - Intergenic
1046484238 8:114864712-114864734 TTGAATCTATAGATCAAGTTGGG - Intergenic
1046825975 8:118692197-118692219 TTGAATCTGTAGATTGATTTGGG + Intergenic
1047867093 8:129037189-129037211 TTGAATCTACACATCAATTTGGG - Intergenic
1048415258 8:134221072-134221094 CTGAATCTACAGATCACTTTGGG - Intergenic
1048562091 8:135550790-135550812 TTGAATCTATAGATCAGTTTGGG + Intronic
1049049036 8:140177662-140177684 TTGAATATAAAGATCAATTTGGG + Intronic
1049137189 8:140913768-140913790 TTGAATCTATGGATTGATTTGGG - Intronic
1049485918 8:142861047-142861069 TTGAATCTACAGATTGCTTTGGG + Intronic
1050002146 9:1088700-1088722 TTGAATGTACAGATTAATTTGGG + Intergenic
1050426856 9:5520007-5520029 TTGAATCCATAGATCAATTTGGG - Intronic
1050464921 9:5911955-5911977 TTGAATCTGCAGATTGCTTTGGG + Intronic
1050617930 9:7421998-7422020 TTGAATCTGCAGATGGCTTTGGG + Intergenic
1050634716 9:7599517-7599539 TTGAATCTATAGATCACTTTGGG - Intergenic
1050695233 9:8271992-8272014 TTGAGTCTACAGATCAAGTTGGG + Intergenic
1050759313 9:9047327-9047349 TTGAATCTATAGATTGCTTTGGG - Intronic
1050766072 9:9135395-9135417 GTGTATACACACATCGATTTGGG - Intronic
1050784257 9:9379603-9379625 TTGAATCTACAGATGAAGTTGGG + Intronic
1050792724 9:9494736-9494758 TTGAATCTATAGATCACTTTGGG - Intronic
1051317239 9:15853142-15853164 TTGAATTTATAGATCAATTTGGG + Intronic
1051322057 9:15915193-15915215 TTGGATCTATAGATTGCTTTGGG + Intronic
1051427575 9:16949028-16949050 TTGAATCTGTAGATCAATTTAGG + Intergenic
1051427588 9:16949396-16949418 TTGAATCTGTAGATCAATTTCGG - Intergenic
1051567199 9:18514058-18514080 TTGTATCTATAGATCACATTGGG + Intronic
1051607749 9:18932603-18932625 TTGAATCTACAGATCAATTTGGG + Intronic
1051807660 9:21013570-21013592 CTGAATCTACAGATCAATTTGGG + Intronic
1051869258 9:21717369-21717391 TTGAATCTATAGATTGCTTTGGG - Intergenic
1051914741 9:22194826-22194848 TTGCATCTATAAATCGCTTTGGG + Intergenic
1052079406 9:24185628-24185650 ATGTATGTGCAGATCCATTTGGG + Intergenic
1052144684 9:25034435-25034457 TTGAATCTACAGATTGCTTTTGG - Intergenic
1052247488 9:26353859-26353881 TTGAATCTGCAGATTGCTTTGGG - Intergenic
1052318093 9:27137216-27137238 TTTTATCAAAAGATAGATTTAGG - Intronic
1052651049 9:31301677-31301699 TTGAATCTATAGATTGCTTTGGG - Intergenic
1052751564 9:32497116-32497138 TTGAATCTGCAGTTCGCTTTTGG + Intronic
1052751902 9:32500291-32500313 TTGAATATACAGATCAATGTAGG + Intronic
1053033697 9:34806283-34806305 TTGAATCTATAGATCAATGTGGG + Intergenic
1053552453 9:39098310-39098332 TTTTATTTACAGATATATTTGGG - Intronic
1053729311 9:41036557-41036579 TTGAATCTATAGAGCCATTTGGG - Intergenic
1053816574 9:41918474-41918496 TTTTATTTACAGATATATTTGGG - Intronic
1054106834 9:61062156-61062178 TTTTATTTACAGATACATTTGGG - Intergenic
1054614023 9:67268969-67268991 TTTTATTTACAGATACATTTGGG + Intergenic
1054699201 9:68395509-68395531 TTGAATCTATAGAGCCATTTGGG + Intronic
1054880690 9:70141855-70141877 TTGTTTGTACAGATCCATTTTGG + Intronic
1055204775 9:73715079-73715101 TTGAATCTACAGCTACATTTTGG + Intergenic
1055245987 9:74243208-74243230 TTGAATCTACACATTGCTTTAGG + Intergenic
1055254422 9:74350587-74350609 TTGAATCTATAGATCTATTAGGG + Intergenic
1055304605 9:74916352-74916374 TTGAATCCATAGATCGCTTTTGG - Intergenic
1055464236 9:76548358-76548380 TTGAACCTATAGATCAATTTGGG + Intergenic
1055745110 9:79435350-79435372 TTGAATCTGTAGATTGATTTGGG - Intergenic
1055811277 9:80150925-80150947 TTGAATCTGTAGATTGATTTGGG + Intergenic
1056000512 9:82211372-82211394 TTGAATCTACAGATGAATGTAGG - Intergenic
1056012730 9:82349174-82349196 TTGAATCTGCAGATTGCTTTGGG + Intergenic
1056155249 9:83828402-83828424 TTGAATCTGTAGATCAATTTGGG - Intronic
1056171739 9:83992048-83992070 TTGAATCTATAGATGAATTTGGG + Intronic
1056308686 9:85318434-85318456 TTTAATCTATAGATCAATTTGGG - Intergenic
1056355237 9:85794711-85794733 TTGAATCTGTAGATCAATTTGGG + Intergenic
1056588256 9:87943138-87943160 TTGAATCTGTAGATCAATTTGGG + Intergenic
1056871184 9:90281508-90281530 TTGAATCTGCAGATCACTTTGGG - Intergenic
1056924801 9:90825295-90825317 TTGAATCTACAGATCAAGCTTGG - Intronic
1057223915 9:93276027-93276049 ATGCATCTACAGATCCATTTGGG - Intronic
1057364456 9:94405859-94405881 TTGAATCTGCAGATCACTTTTGG + Intronic
1057473400 9:95378610-95378632 TTGAATTTATAGATCAATTTGGG + Intergenic
1057658875 9:96982208-96982230 TTGAATCTGCAGATCACTTTTGG - Intronic
1057808373 9:98237830-98237852 TTGAATCTGTAGATCAATTTGGG + Intronic
1057926562 9:99156910-99156932 TTGAATCTATAGAACAATTTGGG - Intergenic
1057970165 9:99547641-99547663 TTGAATCTATAGATTGCTTTAGG + Intergenic
1058102728 9:100935130-100935152 TTGAATCTATAGATTGCTTTGGG + Intergenic
1058194977 9:101962146-101962168 TTGATTCTATAGATCGATTTGGG + Intergenic
1058233463 9:102460595-102460617 TTGTATCTATAAATTGCTTTGGG - Intergenic
1058326551 9:103705554-103705576 TTTAATCTAAAGATCAATTTGGG - Intergenic
1058392274 9:104509256-104509278 TTGAATCTATAGATTGCTTTGGG + Intergenic
1058454018 9:105122574-105122596 ATAAATCTACAGATCAATTTGGG - Intergenic
1058515394 9:105767505-105767527 TTGCATCTATAGATTAATTTGGG + Intronic
1058918421 9:109589751-109589773 TTGAATCTGTAGATCGCTTTGGG + Intergenic
1059066078 9:111085600-111085622 TTGAATCTGCAGATCACTTTGGG + Intergenic
1059095133 9:111404983-111405005 TTGAATCTGTAGATCGTTTTTGG - Intronic
1059347784 9:113642648-113642670 TTGAATCTGTAGATCAATTTGGG + Intergenic
1059394084 9:114020381-114020403 TTGAATCTGTAGATCAATTTGGG + Intronic
1059474789 9:114536977-114536999 TTGAACCTGCAGATCAATTTTGG - Intergenic
1059606046 9:115837506-115837528 TTGAAGCTATAGATCCATTTTGG - Intergenic
1059611847 9:115906490-115906512 TTGAATCTGCAGCTCGCTTTGGG + Intergenic
1059666988 9:116456420-116456442 TTGAATCTATAGATTGCTTTGGG - Intronic
1059667170 9:116458833-116458855 TTGAATCTACAGATAAATTTGGG - Intronic
1059706555 9:116829083-116829105 TTGAATCTGCAGATTGCTTTGGG - Intronic
1059881738 9:118697899-118697921 TTGAATCTATAGATCAAATTTGG - Intergenic
1060320019 9:122549926-122549948 TTGAATCTATAGATTGCTTTGGG + Intergenic
1060323269 9:122586264-122586286 TTGAATCTATAGATCAATCTGGG - Intergenic
1060433647 9:123573351-123573373 TTGAATCTATAGATCAATTTAGG + Intronic
1060447142 9:123700309-123700331 TTGACTCTATAGATCAATTTGGG + Intronic
1060865531 9:126992582-126992604 TTGAATCTGTAGATCCATTTGGG + Intronic
1061447118 9:130645746-130645768 ATGAATCTATAGATCAATTTGGG + Intergenic
1061815693 9:133193602-133193624 TTGCATCTATAGATCAATTTGGG - Intergenic
1062127920 9:134874771-134874793 TTGCATCTGCAGATCAATTTGGG + Intergenic
1186291284 X:8102656-8102678 TTGAATCTCTAGATCAATTTTGG - Intergenic
1186655230 X:11605062-11605084 TGGTATCTACTGATCTGTTTGGG + Intronic
1186668682 X:11746390-11746412 ATGAATCTATAGATCAATTTAGG + Intergenic
1187335803 X:18380463-18380485 TTGAATCTATAGATCAAATTGGG + Intergenic
1187371561 X:18712227-18712249 TTGAATCTGTAGATCAATTTGGG + Intronic
1187431789 X:19231804-19231826 TTGAATCTACAAATCACTTTGGG - Intergenic
1187530461 X:20091808-20091830 GTCTATCTACAGATTGTTTTTGG - Intronic
1187579065 X:20589258-20589280 TTGAATCTATAGATTGCTTTGGG + Intergenic
1187643805 X:21324146-21324168 TTGAATCTATAGATCAGTTTGGG + Intergenic
1187645003 X:21337844-21337866 TTGACTCTACAGATTGCTTTGGG - Intergenic
1187760938 X:22583934-22583956 TTAAACCTAGAGATCGATTTGGG + Intergenic
1187808758 X:23152054-23152076 TTGAATTTATAGATCAATTTGGG - Intergenic
1188279537 X:28247689-28247711 TTCTATGTAAAGATCGATTAAGG - Intergenic
1188388112 X:29586606-29586628 TTGAATCTATAGATTGCTTTGGG + Intronic
1188492416 X:30751533-30751555 TTGAATCTATAGATTGTTTTGGG + Intergenic
1188705003 X:33316787-33316809 TGAAATCTATAGATCGATTTGGG + Intronic
1188915621 X:35906142-35906164 TTGAATCTGCAGATTGTTTTGGG + Intergenic
1188916295 X:35915599-35915621 TTGAATCTGCAGATTGCTTTGGG - Intergenic
1189024169 X:37373361-37373383 TTGAATCTATAGATTGCTTTGGG + Intronic
1189361443 X:40356225-40356247 TTGAATCTGAAGATCAATTTGGG - Intergenic
1189527740 X:41842740-41842762 CTGAATCTATAGATCAATTTGGG + Intronic
1189598580 X:42596370-42596392 TTGAATCTGCAGATTGCTTTGGG - Intergenic
1189657362 X:43259406-43259428 TTGAATCTACAGATTGCTTTTGG + Intergenic
1189718450 X:43889279-43889301 TTGAATCTATAGATCACTTTGGG + Intergenic
1189769498 X:44409790-44409812 TTGAGTCTATAGATCAATTTGGG - Intergenic
1189881133 X:45493532-45493554 TTGAATCTACAGGTTGCTTTGGG + Intergenic
1190450477 X:50575137-50575159 TTGAATTTATAGATCGATTTTGG + Intergenic
1190451990 X:50591460-50591482 TTGAATCTGTAGATCAATTTGGG + Intergenic
1190492437 X:50995531-50995553 TTGAATATACAGATCAATTTTGG - Intergenic
1190547119 X:51539608-51539630 TTGAATCTATAGATCAAGTTGGG + Intergenic
1190820756 X:53969546-53969568 TGGAATCTATAGATCGTTTTTGG - Intronic
1190962447 X:55266293-55266315 TTGAATCTATAGCTCAATTTGGG - Intronic
1190992943 X:55571092-55571114 TTGAATCTATAGATTGCTTTGGG - Intergenic
1191156543 X:57280170-57280192 TTGAATCTATAGACCAATTTGGG - Intergenic
1191656729 X:63606654-63606676 TTGTACCTGTAGATTGATTTGGG - Intergenic
1191817996 X:65269958-65269980 TTAAATCTACATATTGATTTGGG - Intergenic
1191919703 X:66241939-66241961 TTGAATCTACAAATTGTTTTGGG - Intronic
1192187871 X:68965530-68965552 TTTAATCTACAGATCAAGTTGGG + Intergenic
1192188215 X:68971588-68971610 TTGAATCTATAGATTGCTTTGGG - Intergenic
1192303408 X:69930958-69930980 TTGAATCTATAGATCAATTTTGG - Intronic
1192375864 X:70561078-70561100 TTGAATCTATAGATCAATTTGGG + Intronic
1192391706 X:70735648-70735670 TTGAATCTGCAGATCAATTTGGG - Intronic
1192527102 X:71856497-71856519 TTGAATCTACAAATTGCTTTGGG + Intergenic
1192626739 X:72736577-72736599 TTGAATCTATAGATTGCTTTGGG + Intergenic
1192838692 X:74830619-74830641 TTGAATCTACAGATTGCTTTGGG + Intronic
1192881519 X:75289377-75289399 TTGGATCTATAGATTGCTTTGGG - Intronic
1192990199 X:76444372-76444394 TTGTATCTGTAGATTGCTTTGGG + Intergenic
1193022663 X:76807566-76807588 TTGAATCTGCAGATTGCTTTGGG - Intergenic
1193093305 X:77518579-77518601 TTGTATCTATGGATTGCTTTGGG - Intronic
1193146988 X:78086887-78086909 TTGAATCTATAGATTGCTTTGGG + Intronic
1193204479 X:78731542-78731564 TTATATCTGCAGATTGCTTTGGG + Intergenic
1193227100 X:78996982-78997004 TTGAATCTGCAGATTGCTTTGGG - Intergenic
1193299464 X:79872307-79872329 TTGAATCTACAAATTGCTTTGGG - Intergenic
1193354704 X:80504793-80504815 TTAAATCTGCAGGTCGATTTGGG - Intergenic
1193393007 X:80951215-80951237 TTGAATCTAAAGATCAATTTGGG + Intergenic
1193399274 X:81022451-81022473 TTGAATCTATAGATCAAGTTGGG - Intergenic
1193490271 X:82141360-82141382 TTGAATCTACAGATTTCTTTGGG - Intergenic
1193503681 X:82311620-82311642 TTGAATCTTTAGATCAATTTGGG + Intergenic
1193552062 X:82906644-82906666 TTGAATCTAGAGATAAATTTAGG + Intergenic
1193626422 X:83827177-83827199 TTGAATCTATAGATTGCTTTGGG - Intergenic
1193887469 X:87000578-87000600 TTGAATCCATAGATCGTTTTGGG - Intergenic
1193888145 X:87008561-87008583 TTAAATCTATAGATCAATTTAGG - Intergenic
1193933665 X:87588220-87588242 TTGAATCTATAGATTGCTTTGGG - Intronic
1193970433 X:88044351-88044373 TTGTATCTACAGGTTGCTTTGGG - Intergenic
1193986495 X:88247666-88247688 TTGAATCTGTAGATCAATTTGGG + Intergenic
1194060724 X:89193789-89193811 TTGAATCTACAGATTTAGTTGGG + Intergenic
1194071964 X:89336626-89336648 TTGTATCTGTAGATTGTTTTGGG - Intergenic
1194171360 X:90587493-90587515 TTGAATCTGCAGATTGCTTTGGG - Intergenic
1194171778 X:90594626-90594648 TTGCATCTGTAGATTGATTTGGG + Intergenic
1194234353 X:91363550-91363572 TTTAATCTACAGATCAATTTTGG + Intergenic
1194234801 X:91369623-91369645 TTGAATCTATAGATCAAGTTAGG + Intergenic
1194236281 X:91387972-91387994 TTGAATCTATAGATTGCTTTGGG - Intergenic
1194385038 X:93242395-93242417 TTGAATCTATAGATTGCTTTGGG - Intergenic
1194395721 X:93383063-93383085 TTGAATCTATAGATTGTTTTTGG - Intergenic
1194532363 X:95067371-95067393 TTGAATCTACAGATAAAATTTGG - Intergenic
1194563480 X:95451510-95451532 TTGAATCTGCAGTTGGATTTCGG + Intergenic
1194652130 X:96528290-96528312 TGGAATCTATAGATCAATTTAGG - Intergenic
1194769854 X:97888786-97888808 TTGAATCTACAGATTAATTTGGG + Intergenic
1194876535 X:99195855-99195877 TAGTATCTATAGATTGTTTTTGG + Intergenic
1194901548 X:99518267-99518289 TTGAATCTATAGATTGCTTTTGG - Intergenic
1194926491 X:99831532-99831554 TTGAATCTATAAATTGATTTGGG - Intergenic
1194929873 X:99874222-99874244 TTGAATCCATAGATCAATTTTGG - Intergenic
1195331365 X:103804588-103804610 TTGATTCTATAGATCAATTTGGG + Intergenic
1195396679 X:104418435-104418457 TTGAATCTATAGATTGCTTTGGG - Intergenic
1195499787 X:105582385-105582407 TTGAATCTATAGATCCATTTGGG + Intronic
1195609068 X:106843773-106843795 TTGAATCTGTAGATCAATTTCGG + Intronic
1195682366 X:107558083-107558105 TTGAAACTATAGATCAATTTGGG + Intronic
1195730517 X:107962354-107962376 TTGTATCTGTAGATTGCTTTGGG + Intergenic
1196163622 X:112513842-112513864 TTGTTTCTACACTTCCATTTTGG - Intergenic
1196261168 X:113583332-113583354 TTGAATTTATAGATAGATTTAGG - Intergenic
1196305060 X:114092279-114092301 TTGCATCTGCAGATTGCTTTGGG - Intergenic
1196316009 X:114224632-114224654 TTGAATCTGCAGATAGCTTTGGG - Intergenic
1196323635 X:114374254-114374276 TTGAATCTCTAGATCGACTTGGG - Intergenic
1196352517 X:114748339-114748361 TTGAATCTACAGATCATTTGGGG - Intronic
1196849951 X:119927867-119927889 TTGAATATAAAGATCAATTTGGG + Intronic
1196970744 X:121105786-121105808 TTGCATATCCAGATCTATTTTGG + Intergenic
1197072687 X:122319436-122319458 TTGAATTTGCAGATTGATTTCGG + Intergenic
1197310291 X:124896473-124896495 TTGTAGCTATAGAACTATTTTGG - Intronic
1197599042 X:128505531-128505553 TTAAATCTACAGATCAATTTGGG - Intergenic
1197642519 X:128982612-128982634 TTGTATCTATAAATTGCTTTCGG - Intergenic
1197651544 X:129070791-129070813 TTGAATCTATAGATCATTTTGGG + Intergenic
1197676208 X:129333669-129333691 TTGCATCTGCAGATTGCTTTGGG - Intergenic
1197683299 X:129409731-129409753 TTGAATCTATACATCAATTTGGG - Intergenic
1197730835 X:129808143-129808165 TTGAATCTATAGATCAATTTGGG - Intronic
1197926661 X:131654030-131654052 TTGAATCTATAGATTGCTTTGGG + Intergenic
1198007610 X:132513932-132513954 TTGAATCTATAGATCTATTTGGG - Intergenic
1198195893 X:134361471-134361493 TTGAATCTGTAGATCAATTTGGG - Intergenic
1198268055 X:135029180-135029202 TTGAATCTATACATCAATTTTGG + Intergenic
1198283489 X:135167022-135167044 TTGAATCTATAGATTGCTTTAGG - Intronic
1198285794 X:135190271-135190293 TTGAATCTATAGATTGCTTTAGG - Intergenic
1198501152 X:137248347-137248369 CTGAATCTACAGATCATTTTGGG - Intergenic
1198514553 X:137392126-137392148 TTGAATCTATAAATCGACTTTGG - Intergenic
1198570820 X:137954528-137954550 TTGCATCTATAGATTGCTTTGGG + Intergenic
1198930155 X:141848701-141848723 TTGAATCTATAAATCGCTTTGGG - Intronic
1198945935 X:142013868-142013890 TTGAAGCTACAGATTAATTTGGG + Intergenic
1199014313 X:142794807-142794829 TTGAATCCATAGATCAATTTGGG + Intergenic
1199107786 X:143891291-143891313 TTGAATCTATAGATTGCTTTGGG + Intergenic
1199128488 X:144155885-144155907 TTGAATTTATAGATCAATTTGGG - Intergenic
1199358624 X:146890692-146890714 TTGAATCTATAGATTGCTTTGGG - Intergenic
1199584498 X:149399539-149399561 TTGAATCTACAGATCAATTTGGG + Intergenic
1199781508 X:151065032-151065054 TTGGATCTGTAGATCAATTTTGG + Intergenic
1199784987 X:151097328-151097350 TTGGATCTGTAGATCAATTTTGG - Intergenic
1199820873 X:151444176-151444198 TTGAATCCATAGATCAATTTGGG + Intergenic
1199883087 X:151991730-151991752 TTGAATCTATAAATCAATTTTGG + Intergenic
1199937830 X:152594008-152594030 CTGAATCTACAGATCAATCTGGG + Intergenic
1200297589 X:154937846-154937868 TTGATTCTGCAGATCAATTTGGG - Intronic
1200304915 X:155014849-155014871 TTGAATCTGTAGATCAATTTGGG - Intronic
1200332540 X:155312733-155312755 TTGAATCTATAGATTGCTTTGGG + Intronic
1200517592 Y:4165247-4165269 TTGAATCTGCAGATTGCTTTGGG - Intergenic
1200518007 Y:4172372-4172394 TTGCATCTGTAGATTGATTTAGG + Intergenic
1201309308 Y:12581487-12581509 TTGAATCTATAGATTGCTTTGGG - Intergenic
1201316623 Y:12653589-12653611 TTGAATCTGTAGATCAATTTGGG + Intergenic
1201688095 Y:16729738-16729760 ATCTATCTACAAATCTATTTAGG - Intergenic
1201966882 Y:19747234-19747256 TTGAATCTACAGACAAATTTAGG + Intergenic
1202043087 Y:20707015-20707037 TGGAATCTACAGATTGTTTTGGG - Intergenic