ID: 1018789355

View in Genome Browser
Species Human (GRCh38)
Location 6:167134751-167134773
Sequence CAGGGAAAAGAGGAGGAAGA TGG
Strand +
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 2335
Summary {0: 1, 1: 4, 2: 26, 3: 233, 4: 2071}

Found 7 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1018789352_1018789355 -7 Left 1018789352 6:167134735-167134757 CCACGTGGTGCGAGAGCAGGGAA 0: 1
1: 0
2: 0
3: 7
4: 81
Right 1018789355 6:167134751-167134773 CAGGGAAAAGAGGAGGAAGATGG 0: 1
1: 4
2: 26
3: 233
4: 2071
1018789348_1018789355 -1 Left 1018789348 6:167134729-167134751 CCAGGCCCACGTGGTGCGAGAGC 0: 1
1: 0
2: 0
3: 14
4: 99
Right 1018789355 6:167134751-167134773 CAGGGAAAAGAGGAGGAAGATGG 0: 1
1: 4
2: 26
3: 233
4: 2071
1018789351_1018789355 -6 Left 1018789351 6:167134734-167134756 CCCACGTGGTGCGAGAGCAGGGA 0: 1
1: 0
2: 0
3: 5
4: 83
Right 1018789355 6:167134751-167134773 CAGGGAAAAGAGGAGGAAGATGG 0: 1
1: 4
2: 26
3: 233
4: 2071
1018789345_1018789355 13 Left 1018789345 6:167134715-167134737 CCCGCTTGGCATGGCCAGGCCCA 0: 1
1: 0
2: 3
3: 25
4: 245
Right 1018789355 6:167134751-167134773 CAGGGAAAAGAGGAGGAAGATGG 0: 1
1: 4
2: 26
3: 233
4: 2071
1018789342_1018789355 23 Left 1018789342 6:167134705-167134727 CCTAGCTGCTCCCGCTTGGCATG 0: 1
1: 0
2: 0
3: 1
4: 113
Right 1018789355 6:167134751-167134773 CAGGGAAAAGAGGAGGAAGATGG 0: 1
1: 4
2: 26
3: 233
4: 2071
1018789341_1018789355 24 Left 1018789341 6:167134704-167134726 CCCTAGCTGCTCCCGCTTGGCAT 0: 1
1: 0
2: 0
3: 4
4: 78
Right 1018789355 6:167134751-167134773 CAGGGAAAAGAGGAGGAAGATGG 0: 1
1: 4
2: 26
3: 233
4: 2071
1018789346_1018789355 12 Left 1018789346 6:167134716-167134738 CCGCTTGGCATGGCCAGGCCCAC 0: 1
1: 0
2: 0
3: 17
4: 225
Right 1018789355 6:167134751-167134773 CAGGGAAAAGAGGAGGAAGATGG 0: 1
1: 4
2: 26
3: 233
4: 2071

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1018789355 Original CRISPR CAGGGAAAAGAGGAGGAAGA TGG Intronic
Too many off-targets to display for this crispr