ID: 1018790359

View in Genome Browser
Species Human (GRCh38)
Location 6:167143516-167143538
Sequence CGCTTTCTCCTGAAGGCCGG AGG
Strand +
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 2 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1018790355_1018790359 1 Left 1018790355 6:167143492-167143514 CCAGGTCTGGTGCACAAAACCAC No data
Right 1018790359 6:167143516-167143538 CGCTTTCTCCTGAAGGCCGGAGG No data
1018790352_1018790359 28 Left 1018790352 6:167143465-167143487 CCTGAACACAGGTGAAACGCATC No data
Right 1018790359 6:167143516-167143538 CGCTTTCTCCTGAAGGCCGGAGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1018790359 Original CRISPR CGCTTTCTCCTGAAGGCCGG AGG Intergenic
No off target data available for this crispr