ID: 1018790914

View in Genome Browser
Species Human (GRCh38)
Location 6:167147032-167147054
Sequence AATCGCTGCCTCTGGGGAAC TGG
Strand +
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 206
Summary {0: 1, 1: 0, 2: 2, 3: 15, 4: 188}

Found 3 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1018790904_1018790914 11 Left 1018790904 6:167146998-167147020 CCTTTTGAAAATCTGCACCGCCA 0: 1
1: 0
2: 0
3: 6
4: 93
Right 1018790914 6:167147032-167147054 AATCGCTGCCTCTGGGGAACTGG 0: 1
1: 0
2: 2
3: 15
4: 188
1018790906_1018790914 -9 Left 1018790906 6:167147018-167147040 CCAGCCATCCCCGAAATCGCTGC 0: 1
1: 0
2: 1
3: 8
4: 102
Right 1018790914 6:167147032-167147054 AATCGCTGCCTCTGGGGAACTGG 0: 1
1: 0
2: 2
3: 15
4: 188
1018790905_1018790914 -6 Left 1018790905 6:167147015-167147037 CCGCCAGCCATCCCCGAAATCGC 0: 1
1: 0
2: 0
3: 5
4: 88
Right 1018790914 6:167147032-167147054 AATCGCTGCCTCTGGGGAACTGG 0: 1
1: 0
2: 2
3: 15
4: 188

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1018790914 Original CRISPR AATCGCTGCCTCTGGGGAAC TGG Intronic
902294422 1:15456800-15456822 AACCAGTGCCTCTGGGTAACAGG - Intronic
902328114 1:15716010-15716032 ACTGGGTGCCTCTGGGGGACTGG + Intronic
902813036 1:18900243-18900265 AACCGCTGCTTTTGAGGAACGGG - Intronic
905685718 1:39906339-39906361 AATAGCTGCCTTTGGGGAGTGGG - Intergenic
907095622 1:51777669-51777691 AATTTCTGCCTTTGGGGAATTGG - Intronic
907297620 1:53465360-53465382 AAGCTCTGCCACTGGGGCACTGG + Intronic
909158783 1:72117670-72117692 AATGTCTGGCTCTGGGGGACTGG - Intronic
909375300 1:74934390-74934412 AATAGTTGCCTCTGAGGAGCAGG + Intergenic
910262886 1:85308469-85308491 AAAAGATGCCTCTGGGGAAAAGG + Intergenic
910322977 1:85970235-85970257 AATTGGAGCCTTTGGGGAACTGG - Exonic
910445390 1:87294681-87294703 AGTCCCTTCCTCTGGGGACCAGG + Intergenic
911468725 1:98288668-98288690 AATGGCTGCCTCTGAAGAAGAGG + Intergenic
914985263 1:152451007-152451029 AATCTCTCCCTCTGGGGGAAGGG - Intergenic
915190643 1:154147727-154147749 AACCTCTGCCTCTGGGGTTCTGG + Intronic
917279258 1:173364494-173364516 AATGGTTTCCTCTGGGGAACTGG + Intergenic
917495994 1:175540702-175540724 AGTGGCTACCTCTGGGGAAGGGG - Intronic
917908960 1:179620193-179620215 AATGGCTGTCTCTGGGTCACAGG + Intronic
918215531 1:182390139-182390161 AACCTCTGCCTCTGGGGTTCAGG - Intronic
919667729 1:200308648-200308670 AACCTCTGCCTCTGGGGTCCCGG + Intergenic
921283605 1:213589819-213589841 ACTCTCAGCCTCTGGGGAGCAGG - Intergenic
923054864 1:230418427-230418449 AATGGCTACCTCTGGGGACAGGG + Intronic
924148417 1:241101412-241101434 AAGCTCTGCCTCTGGGGTTCAGG - Intronic
1062889741 10:1049171-1049193 GGACGCTGCCTCTGCGGAACTGG - Intergenic
1067529889 10:47062620-47062642 AGTGATTGCCTCTGGGGAACGGG - Intergenic
1067854072 10:49776567-49776589 AATAACTGCCTCTGAGGAAGTGG - Intergenic
1071809320 10:89161385-89161407 AATAGTTACCTCTGGGGAATAGG - Intergenic
1075083550 10:119399349-119399371 CTTCGCTGCATCTGGGGCACTGG - Intronic
1075779862 10:125010366-125010388 AATCGCAGCCTCTGGGAAGCTGG - Intronic
1076179951 10:128399400-128399422 AATGCCTGCCTATGGGGCACTGG + Intergenic
1076848876 10:133083318-133083340 AATGGCGGCCTCCGGGGAGCGGG - Intronic
1077495133 11:2883415-2883437 CATCGCGGACTCTGGGGAAGGGG - Exonic
1078390095 11:10929930-10929952 AATCTCTGCCTCTTGGGTTCAGG + Intergenic
1080404493 11:31966895-31966917 ACTCGCTGGCTCTGGGGTCCTGG + Intronic
1080457440 11:32429579-32429601 TGTTGCTGCCTCTGGGGAAAAGG + Intronic
1081411677 11:42766022-42766044 ATTGGTTGCCTCTGGGGAATAGG + Intergenic
1081640265 11:44748314-44748336 AACCGCCGCCTCTGGGGTTCAGG - Intronic
1081642582 11:44766406-44766428 AACCGCTTCCTGTGGGGATCAGG - Intronic
1083947400 11:65931934-65931956 AGACGCTGCCTTTGGAGAACAGG + Intergenic
1084199419 11:67545482-67545504 AATCCCTGCATCTAGGGAGCAGG - Intergenic
1084204926 11:67585640-67585662 ACACGCTGCCTCTGCTGAACTGG - Intronic
1088316509 11:108512270-108512292 ATTCGCTGACTCAGGAGAACTGG + Exonic
1089635617 11:119809770-119809792 ATTCCCAGGCTCTGGGGAACAGG + Intergenic
1090334069 11:125951076-125951098 AGACGCTGCCACTGGGGAGCTGG - Intergenic
1090354694 11:126132325-126132347 AATATCTGCCTCTGGTGAACTGG + Intergenic
1092110716 12:5962040-5962062 AAGCACTGCCTATGAGGAACAGG + Intronic
1092904755 12:13091175-13091197 TATGGCTGGCTCTGGGGAAAGGG - Intronic
1093838223 12:23862893-23862915 AATCGGTGGCTCTGTGGAATTGG - Intronic
1095865867 12:46971603-46971625 TATGGCTGCCTTTGGGGAAAAGG - Intergenic
1095982441 12:47981061-47981083 GATCCCCGTCTCTGGGGAACAGG - Intronic
1096170860 12:49468556-49468578 AACCTCTGCCTCTGGGGCTCAGG + Intronic
1096623233 12:52877637-52877659 GATAGCTGGCTCTGGGGGACAGG + Intergenic
1098525030 12:71477316-71477338 AATGGATGCCTCTGGGAAATGGG + Intronic
1100722275 12:97371576-97371598 ATTTGTTGCCTCTGGGGAGCCGG + Intergenic
1103077196 12:117993574-117993596 GGTGGCTGCCTCTGGGGAGCAGG - Intergenic
1103518283 12:121521382-121521404 AAAAGCTTCCTCTGGGGACCTGG + Intronic
1103556926 12:121771909-121771931 AAGGGTTGCCTCTGGGGAAGGGG + Intronic
1103908183 12:124338002-124338024 AATCCCTGGCTGTGGGGAGCAGG - Intronic
1105420895 13:20251437-20251459 AATAGCTTGCTCTGGGGAAGTGG + Intergenic
1107272046 13:38631401-38631423 AACCTCTGCCTCTGGGGTTCAGG + Intergenic
1113920643 13:113906797-113906819 CATCTCTGCCTCTTGGGAATGGG + Intergenic
1118893468 14:69927592-69927614 AACCTCTGCCTCTGGGGCTCAGG - Intronic
1119843031 14:77807589-77807611 AATCTCCGCCTCTGGGGTTCAGG + Intronic
1122418449 14:101561226-101561248 AGCCGCTGCCGCTGGGGACCGGG - Intergenic
1122572079 14:102711443-102711465 AATTGCTGCTTCTGAGTAACAGG - Intronic
1122646085 14:103195122-103195144 AACCTCTGCCTCTGGGGTCCCGG - Intergenic
1124067022 15:26354149-26354171 TATTGCTGCCTATGGGGAACAGG - Intergenic
1127077932 15:55346427-55346449 AATAGTTACCTCTGGGGAATGGG - Intronic
1127773562 15:62248899-62248921 CATCGCTGTCTCTGGTTAACTGG + Intergenic
1127898247 15:63321622-63321644 AAACGGGGCCTCTGGGGCACAGG - Exonic
1128483489 15:68060763-68060785 AATCTCTGCCTCCGGGGTTCAGG + Intronic
1128968825 15:72087695-72087717 AATGGCTGCCACTGAGGGACTGG - Intronic
1131134706 15:89925017-89925039 GGTGGCTGCCTCTGGGGGACTGG + Intergenic
1132219652 15:100095838-100095860 AATGTCTGCCCCTGGGGACCAGG + Intronic
1132400729 15:101503310-101503332 GATCCCTGCCTCTGGTAAACCGG + Intronic
1133791906 16:9015568-9015590 AATCTCTGACACTGCGGAACTGG + Intergenic
1135791358 16:25399461-25399483 AATGGTTGCCTCTTGGGAACTGG - Intergenic
1138598864 16:58043437-58043459 ATCCACTGCCTGTGGGGAACGGG + Intronic
1139306969 16:65994934-65994956 GATAGCTGTCTCTGGGGAAGAGG + Intergenic
1140807358 16:78545286-78545308 AATCTCTGCTTCTGAGGAAATGG + Intronic
1141953831 16:87356654-87356676 GATCACTGCAGCTGGGGAACTGG - Intronic
1142680109 17:1542516-1542538 ACTGGCTGTCTCTGGGAAACTGG - Intronic
1142981739 17:3676393-3676415 ACTGGCTGCCTCTGGGGAACCGG + Intronic
1143039621 17:4024116-4024138 AATCGCTGCCTCTCAGGTATGGG + Intronic
1143564104 17:7711235-7711257 AATCGCTCCTTCTGGGGAACAGG + Exonic
1145756243 17:27392417-27392439 AATGGTTGCCTCTGGGGAGTGGG - Intergenic
1145923459 17:28628604-28628626 TATCACTGCCTCTGTGGCACTGG - Intronic
1146034059 17:29390718-29390740 CGTCGCCGCCTCGGGGGAACCGG - Exonic
1146597415 17:34182686-34182708 AATTGCTGCCTCTGGGTCATTGG - Intergenic
1146924409 17:36734219-36734241 AACCTCTGCCTCTGGGGTTCAGG - Intergenic
1148158324 17:45436101-45436123 ACTGGCAGCTTCTGGGGAACGGG + Exonic
1148549263 17:48541112-48541134 AATTGCTGCCTCTGGGTGACTGG + Intronic
1148680813 17:49472573-49472595 AACCTCTGCCCCTGGGGAAGAGG + Intronic
1149049645 17:52289544-52289566 AATCACTGGCTGGGGGGAACAGG - Intergenic
1150902814 17:69300391-69300413 ACTAGCTGCCTGTGAGGAACTGG - Intronic
1152223376 17:79081585-79081607 GCTCGCTGCCCCTGGGGAACAGG + Intronic
1153551991 18:6271902-6271924 AATCTCTGCCTCTGCGGTCCCGG - Intronic
1155012983 18:21801106-21801128 AATAGCTGCCTCTGTAGAACAGG - Intronic
1159337182 18:67083643-67083665 AACCTCTGCCTCTTGGGATCAGG + Intergenic
1162057026 19:8070938-8070960 AATCTCTGCCTCTTGGGTTCAGG - Intronic
1162656391 19:12134240-12134262 AACCTCTGCCTCTGGGGTTCAGG - Intronic
1162833623 19:13302323-13302345 AATCCCTGCCTCCGTGGAGCAGG - Intronic
1163051271 19:14685957-14685979 AATTGCTGCCTCAGCTGAACAGG + Intronic
1164209147 19:23082781-23082803 AATCTCTGCCTCTTGGGTTCAGG + Intronic
1164848823 19:31461996-31462018 AATGGCTGACTCCTGGGAACAGG + Intergenic
1165020083 19:32917044-32917066 AATCGCTGTTTCTGGGCAATGGG + Intronic
1165544521 19:36523463-36523485 AGTGGCTGCTTCTGGGAAACAGG + Intronic
1166100475 19:40568565-40568587 AATCCCTGCCTCGGGGCACCCGG - Intronic
1166663515 19:44662874-44662896 AATTGCAGCCTCTGGTGACCAGG - Exonic
1166959019 19:46486983-46487005 ACTGGCTACCTCAGGGGAACTGG - Intronic
1167047359 19:47058132-47058154 AATCGCTTCATCTTGGGAAGCGG + Intergenic
926366959 2:12142363-12142385 AAATGCTGCCTCTTGGGGACAGG - Intergenic
926731619 2:16039764-16039786 AGTCACTGCCTCTGGGGAAAAGG - Intergenic
927483985 2:23476407-23476429 AATGGTTATCTCTGGGGAACAGG - Intronic
928388892 2:30893688-30893710 GATGGCTGTCTCTGGGGAAAGGG + Intergenic
929927424 2:46226482-46226504 ATTGGTTGCCTCTGGGGAGCAGG + Intergenic
930867412 2:56135507-56135529 AATGGCAGCCTTTGGGGAAAAGG - Intergenic
932952915 2:76315202-76315224 AAAAACTGCCACTGGGGAACAGG - Intergenic
936281169 2:111141165-111141187 AGTTGGTGCCTATGGGGAACTGG + Intronic
938295864 2:130179075-130179097 AATCTCTGCCTCTCGGCAATAGG + Intronic
938566712 2:132525212-132525234 AATCCCTGCCTTTGGAGCACAGG + Intronic
947472910 2:230414615-230414637 TCTCGCTGCCTCTGGGCAGCAGG - Intergenic
947552892 2:231059636-231059658 AATACCTGCCTCTGGGGATCAGG - Intronic
947709506 2:232303866-232303888 AATCTCTACCTCTGGGGTCCAGG + Intronic
948015941 2:234690608-234690630 CATCGCTGCCTCTAGGCAGCAGG + Intergenic
948924626 2:241087471-241087493 AACAGGTGCCTCTGGGGAGCAGG + Exonic
1169497555 20:6129813-6129835 AATAGTTGCCTCTGGGGAATGGG + Intergenic
1170172447 20:13430447-13430469 AACAGCTGCTTCTGAGGAACCGG - Intronic
1171030264 20:21670292-21670314 ACTCGCTGCCTCTGTGCCACTGG - Intergenic
1172009236 20:31836826-31836848 ACTCTCTGCCTCTGGGGACAAGG - Intergenic
1172136721 20:32691233-32691255 AGTGGCTACCTCTGGGGAATAGG + Intergenic
1174976016 20:55335293-55335315 ATTCGTAGCCTCTGGGGAAAAGG - Intergenic
1175972453 20:62693567-62693589 AGGGGCTGCTTCTGGGGAACCGG - Intergenic
1176105925 20:63386625-63386647 AAGCCCTGGCCCTGGGGAACAGG + Intergenic
1178554790 21:33580113-33580135 AACCTCTGCCTCTGGGGCTCAGG - Intronic
1181925884 22:26358161-26358183 AATCTCTGTCTCTGGGAAAGCGG + Intronic
1182441848 22:30369341-30369363 CAGCTCTGGCTCTGGGGAACTGG - Intronic
1184518266 22:44976597-44976619 AGTTGCAGCCTCTGGGGAGCTGG + Intronic
1185334418 22:50265253-50265275 ATTTCCTGCCTCTGGGGAAATGG + Intronic
950352390 3:12369120-12369142 AATCACTGCCTATGAGGAGCGGG - Intronic
951273883 3:20661360-20661382 AGTGGCTGCCTCTGGGCAAAAGG - Intergenic
954332602 3:49898866-49898888 ACTCTTTGCCTCTGGGGACCAGG - Exonic
959565083 3:107825805-107825827 ACTCTGTGCCTCTGGGTAACCGG - Intergenic
960707181 3:120492720-120492742 AATGGGTGCCTCTTGGGAAGAGG - Intergenic
961119351 3:124360218-124360240 AATGGCTGGCTCTTAGGAACAGG + Intronic
964084317 3:152797832-152797854 TATGGCTGGCTCTGGGGAAAAGG + Intergenic
969917882 4:10508457-10508479 CATCTGTGCCTCTGGGGAAGTGG - Intronic
970775901 4:19673794-19673816 AAGCAGTGCCTCTGGGGAAGTGG + Intergenic
971992988 4:33925466-33925488 AATAAGTGCCTCTGAGGAACTGG + Intergenic
972176263 4:36410180-36410202 AATCTCTGCCTCTAGAGAAACGG - Intergenic
972834558 4:42853953-42853975 AATCACAGCCTATGGGGACCCGG + Intergenic
980271587 4:130591079-130591101 CATGGCTGGCTCTGGGGAAAAGG - Intergenic
980859515 4:138482475-138482497 AATCCCTGCTACTGGGGAAGCGG - Intergenic
981695964 4:147559054-147559076 AGTGGTTGCCTCAGGGGAACAGG + Intergenic
982541875 4:156682725-156682747 AACCTCTGCCTCTGGGGTTCAGG + Intergenic
982941710 4:161566875-161566897 ATTTGCTGCCTCTGGTGCACTGG - Intronic
983487641 4:168350731-168350753 AACCTCTGCCTCTGGGGTTCAGG - Intergenic
985145918 4:186894430-186894452 AGTGGCTGCTTCTGGGGAAGTGG - Intergenic
986560079 5:9051930-9051952 ACTGGCTGCCCATGGGGAACAGG + Exonic
987799639 5:22677401-22677423 AAGCGCTGTCTCTGAGGAATGGG - Intronic
988517032 5:31913991-31914013 ACTCCCTGCCTCTGGGTGACAGG + Intronic
991281234 5:64916632-64916654 AATATCTGTCTCTGGGGAGCTGG - Intronic
993779696 5:92051086-92051108 AATTCCTGCTTCTGGGGAATGGG + Intergenic
996084637 5:119292097-119292119 CACCTATGCCTCTGGGGAACTGG - Intronic
998494960 5:142580528-142580550 AGTAGTTGCCTCTGGGGAGCAGG + Intergenic
998905456 5:146900080-146900102 AATGGCTGGGGCTGGGGAACCGG + Intronic
999178640 5:149652594-149652616 AAACTCTGCCTCTAGGGATCAGG + Intergenic
1000451030 5:161387013-161387035 ACTGGCTACCTCTGGGGAACGGG + Intronic
1003362242 6:5439065-5439087 AATCGCTGCCCCTAGGAAGCAGG - Intronic
1003511940 6:6789004-6789026 AGTGGCTGCCTCTGGGGAGCAGG + Intergenic
1005415535 6:25596472-25596494 ATTAGTTGCCTCTGGGGAATAGG - Intronic
1005575114 6:27183226-27183248 AATGGGTGCCTCTTGGGAATAGG - Intergenic
1005977101 6:30808093-30808115 TATGGCTGGCTTTGGGGAACAGG + Intergenic
1006944413 6:37775757-37775779 AATGGCTGCCTCTCAGGAGCAGG + Intergenic
1009416699 6:63423540-63423562 AACCTCTGCCTCTGGGGTTCAGG - Intergenic
1010166239 6:72918165-72918187 AAACGTGGCCTCTTGGGAACTGG + Intronic
1012468312 6:99540284-99540306 AGTGGCTGCCTCTGGAGAATGGG + Intergenic
1015461354 6:133495185-133495207 AACCTCTGCCTCTGGGGTTCAGG - Intronic
1017804779 6:157935165-157935187 AAACTCTACCTCTGGGTAACCGG + Intronic
1018790914 6:167147032-167147054 AATCGCTGCCTCTGGGGAACTGG + Intronic
1019938198 7:4269896-4269918 AATCGGAGTCTCTGGGGATCGGG + Intergenic
1022896036 7:34751211-34751233 CATCGTTGCCACTGGGGATCTGG - Intronic
1023042047 7:36180709-36180731 AATCCCTTCCTCTGGGAAGCTGG + Intronic
1024506667 7:50167808-50167830 AAGGGGTGCCTCTGGGGAAAAGG - Intergenic
1027123010 7:75535791-75535813 AACCTCTGCCTCTGGGGTTCAGG + Exonic
1028135141 7:87217372-87217394 AGTTGCTGCCTCTGTGGAAATGG + Intronic
1029407575 7:100385196-100385218 AATAGTTGCCTCTGGGGAGTTGG + Intronic
1030514861 7:110526630-110526652 AATGTCTTCCTCTGGGGAAAAGG + Intergenic
1034157771 7:148969481-148969503 AAGCACTGGCTCTGGTGAACAGG - Intergenic
1036165462 8:6428841-6428863 AGGAGCTGCCTCTGGGGAACAGG - Intronic
1038234905 8:25743332-25743354 AGTGGTTGCCTCTGGGGAAGAGG - Intergenic
1038495944 8:28002795-28002817 AATTGGTGCCTATGGGAAACAGG - Intergenic
1039788849 8:40857991-40858013 AATGATTGCCTCTGGGGAATGGG + Intronic
1041272862 8:56125704-56125726 AATAGTTGCCTCTGGGTGACAGG - Intergenic
1042515062 8:69650526-69650548 AAGCTCTGCCTCTGAGTAACTGG - Intronic
1044047674 8:87458043-87458065 AACCTCTGCCTCTGGGGTTCAGG - Intronic
1055634259 9:78259507-78259529 AATGGTTGCCTCTGGGAAGCTGG + Intronic
1059217618 9:112580703-112580725 AACCTCTGCCTCTGGGGTTCAGG - Intronic
1060771538 9:126335603-126335625 CATCGCTGCCAATGGGAAACAGG + Intronic
1060856638 9:126919048-126919070 AGTGGCTGCCTCTAGGGAAAAGG - Intronic
1189341010 X:40204554-40204576 AGACGCTGCCTCTGGGTGACTGG + Intergenic
1189767734 X:44389250-44389272 AAGCTCTGCCTCTGGGGTTCAGG - Intergenic
1190277639 X:48909470-48909492 AATTGCTGACTCTGGGGGATGGG + Intronic
1191221123 X:57989556-57989578 AATCTCTGCCCCTTGGGTACAGG + Intergenic
1196891058 X:120291383-120291405 ACTTGCTGCCTCTGGGGACCAGG + Intronic
1198839969 X:140846021-140846043 AGTGGTTGCCTCTGGCGAACAGG - Intergenic
1201437712 Y:13977471-13977493 AATTGTTGCCTCTGGGGCAAAGG + Intergenic