ID: 1018792826

View in Genome Browser
Species Human (GRCh38)
Location 6:167162527-167162549
Sequence TAGATTTTGAAGGAAAGGGG AGG
Strand +
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 432
Summary {0: 1, 1: 1, 2: 5, 3: 61, 4: 364}

Found 3 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1018792818_1018792826 19 Left 1018792818 6:167162485-167162507 CCAGTTGGGCAGAGGGGACTGCC 0: 1
1: 0
2: 1
3: 7
4: 168
Right 1018792826 6:167162527-167162549 TAGATTTTGAAGGAAAGGGGAGG 0: 1
1: 1
2: 5
3: 61
4: 364
1018792820_1018792826 -3 Left 1018792820 6:167162507-167162529 CCACTGTGTGTGACCAGTGTTAG 0: 1
1: 0
2: 0
3: 9
4: 169
Right 1018792826 6:167162527-167162549 TAGATTTTGAAGGAAAGGGGAGG 0: 1
1: 1
2: 5
3: 61
4: 364
1018792819_1018792826 -2 Left 1018792819 6:167162506-167162528 CCCACTGTGTGTGACCAGTGTTA 0: 1
1: 0
2: 0
3: 12
4: 136
Right 1018792826 6:167162527-167162549 TAGATTTTGAAGGAAAGGGGAGG 0: 1
1: 1
2: 5
3: 61
4: 364

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1018792826 Original CRISPR TAGATTTTGAAGGAAAGGGG AGG Intronic
901285002 1:8071169-8071191 ATAATTTTGAAGGAAAGGGAGGG - Intergenic
902969315 1:20035111-20035133 TAGATTTTGAAGCGAAGGCAAGG + Intronic
903093605 1:20946802-20946824 AACTTTTTGGAGGAAAGGGGAGG + Intronic
903689905 1:25166192-25166214 CAGATTGTGGGGGAAAGGGGTGG + Intergenic
903818720 1:26084479-26084501 GAGATTTAGAAGGAGATGGGAGG + Intergenic
905012901 1:34759235-34759257 TGGATTGTGTAGGAAATGGGAGG - Intronic
905015605 1:34776562-34776584 TAGATTTTGCTGTAAAGGAGTGG + Intronic
906366373 1:45213522-45213544 CACATTTTGAAGGGATGGGGTGG - Intronic
907364528 1:53947086-53947108 TAGATGGTGAAGGAGAGGAGTGG + Intronic
909078594 1:71082077-71082099 TAGGTTTTGAAGGGAAGGCAAGG - Intergenic
910417350 1:87014853-87014875 TAGTTTTTAAAGGAAAAGTGAGG - Intronic
910688019 1:89938148-89938170 TTGTTTTTGAAGGGCAGGGGTGG + Intergenic
910841030 1:91561355-91561377 TTGATATGGAAGGAAAGGGGTGG - Intergenic
911168523 1:94746253-94746275 AAGATTTTGATGGAGAGGGGAGG - Intergenic
911807753 1:102233493-102233515 TAGATTATGCATGAAAGAGGAGG - Intergenic
912626442 1:111208583-111208605 CTGATTTAGATGGAAAGGGGAGG - Intronic
912694866 1:111833781-111833803 TAGATATTCAAGGAAGGTGGTGG + Intronic
912888864 1:113506159-113506181 TACATTTTGAAGGTTAAGGGAGG + Intronic
913153773 1:116073723-116073745 TATATTATCAAGGAAATGGGGGG - Intergenic
914357706 1:146901875-146901897 TAGATTTTAAGAGAAGGGGGTGG + Intergenic
914875456 1:151510223-151510245 TAGCTTTTGAAGGCTTGGGGAGG + Intergenic
915088602 1:153405792-153405814 TAGGTTTTGAAGGGAAGGCAAGG - Intergenic
915096293 1:153465040-153465062 TAGGTTTTGAAGGGAAGGCAAGG + Intergenic
915915196 1:159936699-159936721 TAGAGTGTGAAGGGAAGGTGGGG - Intronic
916058860 1:161085534-161085556 CAGATTTAGAGGGAAGGGGGTGG + Intronic
916248305 1:162710165-162710187 TAGAGTTTGTAGGAGAGGTGAGG - Intronic
916494434 1:165332835-165332857 TAAATTTTCATGGAAAGGGTTGG + Intronic
916810766 1:168303718-168303740 TAAGTTTTTCAGGAAAGGGGCGG + Intronic
918440358 1:184560552-184560574 TAGGTTTTACAAGAAAGGGGTGG - Intronic
922024036 1:221734035-221734057 TAGAATGTGAAGGAAAAAGGAGG - Intronic
922890760 1:229060070-229060092 GAGATTTTCAAGAAAAGGTGAGG + Intergenic
923354391 1:233139937-233139959 CAGCTTTTGAATTAAAGGGGGGG - Intronic
923998930 1:239529038-239529060 TGGATTATGAAGGAAATGGGAGG - Intronic
1063734623 10:8739218-8739240 TAGGATTTGAAGGAAAGCAGGGG + Intergenic
1063882081 10:10541533-10541555 TAAGTTTTCCAGGAAAGGGGTGG + Intergenic
1063959950 10:11298972-11298994 TAATTTTTAAAGGAAAGGTGGGG - Intronic
1064504277 10:16012370-16012392 TGGATTCTGAATGAAAGGGCTGG + Intergenic
1065023349 10:21518369-21518391 GAGATTTTGGGGGGAAGGGGTGG - Exonic
1065629464 10:27662731-27662753 TAGAATTGGAAGGAAAAGTGGGG + Intergenic
1066504892 10:36031245-36031267 TAGACTGTGAAGGAGATGGGCGG + Intergenic
1067714614 10:48680742-48680764 TACAATTTGAAGGACAGAGGGGG - Intergenic
1068489591 10:57706348-57706370 TAAATGTTCAAGGAAAAGGGAGG + Intergenic
1068846690 10:61684513-61684535 TTGATTTGGAAGGGAATGGGTGG - Intronic
1068949235 10:62760807-62760829 TAGGTTTTGGAGGAAAGAGTTGG - Intergenic
1069001229 10:63268382-63268404 TAGTGTTTCAAGGAAAGTGGGGG - Intronic
1071662748 10:87521439-87521461 TAGTTTCTGGAGGAAAGGGAAGG - Intronic
1072046655 10:91663789-91663811 TAGGTTTTGAAGGGAAGGCGAGG + Intergenic
1072765041 10:98088470-98088492 TACATCTTGTAGCAAAGGGGAGG - Intergenic
1073041791 10:100612806-100612828 TAGGTTTTGCAGGACAGTGGTGG - Intergenic
1073130212 10:101183637-101183659 TGAATTTTCCAGGAAAGGGGTGG - Intergenic
1073145321 10:101277074-101277096 TAGGACTTGAAGGAAAGGTGGGG - Intergenic
1077694674 11:4383528-4383550 TAAATCTGGAAGGAAAGGGATGG + Intergenic
1077824134 11:5786090-5786112 AATATTTTGAGGGAAAGGGCAGG + Intronic
1079261835 11:18889831-18889853 TAGATTTAGAGGGGAAGGGGAGG - Intergenic
1079694884 11:23469169-23469191 TAAATTTTGAAGCAAATGGGAGG + Intergenic
1080174927 11:29351606-29351628 TAGAGTTTGAAGGGAAGGAGGGG - Intergenic
1080845935 11:36026830-36026852 TAAGTTTTCTAGGAAAGGGGTGG - Intronic
1080891037 11:36409421-36409443 GAGATTTTCAAGGAAAGAGGAGG + Intronic
1081331035 11:41800451-41800473 TGGATTTGAAAGGAAAGAGGAGG + Intergenic
1081946652 11:47001714-47001736 TAGATTATGTAGGAAAGAAGTGG - Intronic
1082001653 11:47396313-47396335 AAGATGTTTTAGGAAAGGGGAGG + Intergenic
1083136557 11:60683703-60683725 TAGGTTTTGAAGGGAAGGTAAGG + Intergenic
1083583700 11:63840945-63840967 GAGATGGTGAAAGAAAGGGGAGG - Intronic
1084099362 11:66935529-66935551 TAACTTCAGAAGGAAAGGGGAGG + Intronic
1085040136 11:73322110-73322132 CAGATGTGGAAGGGAAGGGGTGG + Intronic
1085125695 11:74000733-74000755 TCCATTTTGTAGGAAAGTGGGGG + Exonic
1086923103 11:92610576-92610598 GAGATTTTGAAGGTAAAAGGAGG - Intronic
1087277383 11:96174139-96174161 TAGGGTATGAAGGAAAGGAGAGG - Intronic
1087306827 11:96499195-96499217 TAGGTTTTAAAGGGAAGGCGAGG - Intronic
1087357461 11:97112633-97112655 TAGATTTAGGAAGAAAGGTGGGG - Intergenic
1087418308 11:97887034-97887056 AAAAGTTTTAAGGAAAGGGGTGG + Intergenic
1087453495 11:98353739-98353761 CAGATTTTGGAGGAAAGTTGTGG - Intergenic
1088355158 11:108935202-108935224 TGGCTTTTGAAGGATAAGGGAGG + Intronic
1088980147 11:114855418-114855440 AAGATATTCAAGGAAAGGGCTGG + Intergenic
1089168373 11:116495231-116495253 TAGGTTTTGAAGGGAAGGCAAGG + Intergenic
1090255824 11:125283435-125283457 TAGATATTGAAGTACAGGAGAGG - Intronic
1090304779 11:125681961-125681983 TACATTTTGAAAGGAAGGTGAGG + Intergenic
1090648855 11:128789107-128789129 TAGATGTTGAAGCAAAGGGAAGG + Intronic
1091189903 11:133682762-133682784 TAGATTGTGAAACAAAGGTGAGG - Intergenic
1091830291 12:3544444-3544466 TAGGTTTTGAAGGGAAGGCAAGG + Intronic
1092090519 12:5800047-5800069 TAGAATGTGAAGGAAGGGAGAGG + Intronic
1092159357 12:6307578-6307600 TAAATGTGGAAGGAAGGGGGAGG + Intergenic
1092462584 12:8698708-8698730 TAGAATTTGTGGGAAGGGGGGGG - Intronic
1092533416 12:9364151-9364173 TAGGTTTTGAAGGGAAGGCGAGG + Intergenic
1092675281 12:10910650-10910672 TAGTTTTTGAAAGAGTGGGGCGG - Intronic
1094068043 12:26382367-26382389 TAGAATTTGAAGGTAAGGCTAGG + Intronic
1094700005 12:32860561-32860583 TAGAATTTGAGGGCAAGGAGAGG + Intronic
1094874718 12:34627809-34627831 TAGATTGTGAAGGAGAGGCAGGG - Intergenic
1095524356 12:43107653-43107675 TGGACTTTGAAGGAAAAGAGGGG - Intergenic
1095533660 12:43221260-43221282 CAGATTTTGGAGGAAGGGGTTGG - Intergenic
1099297131 12:80842191-80842213 TAAAGTGTGATGGAAAGGGGGGG - Intronic
1099613775 12:84910962-84910984 TAGGTTTTGAAGGGAAGGCGAGG - Intronic
1099984380 12:89646177-89646199 AAGAATTAGGAGGAAAGGGGAGG + Intronic
1100926100 12:99550090-99550112 TAGGCTTTGAAGGGAAGGCGAGG - Intronic
1100948484 12:99817165-99817187 GAGGCTTTGAAGGAAAGGGGGGG - Intronic
1102526190 12:113514137-113514159 TAAATTTTCCGGGAAAGGGGTGG - Intergenic
1102526197 12:113514168-113514190 TAAATTTTCCGGGAAAGGGGTGG - Intergenic
1102818411 12:115887520-115887542 AAGATTCTGAGAGAAAGGGGTGG + Intergenic
1104185324 12:126425147-126425169 TAGGCTTTGAAGGGAAGGTGGGG + Intergenic
1104309602 12:127642726-127642748 TGGGTTTTGAAGGGAAGGCGAGG - Intergenic
1105061894 12:133160408-133160430 TAGGTTTTGAAGGAAAGGTGAGG + Intronic
1105254927 13:18738052-18738074 TAGGTTTGGAAGGCAAGGCGAGG + Intergenic
1106082224 13:26509989-26510011 TAGATTGTGAAGAAAAGGCAGGG + Intergenic
1106927589 13:34629871-34629893 TGGATTTTGAGGGAAAAGAGAGG - Intergenic
1107106132 13:36644657-36644679 TTGATTGTGAAGGAAAGAGATGG + Intergenic
1107438251 13:40401206-40401228 AAGTTTTTGAAGGAAAGTTGGGG - Intergenic
1108426925 13:50312052-50312074 TTGATTTTGCAGGAAAATGGGGG + Intronic
1108455746 13:50611957-50611979 TAGACCTTGAGGGAAAGGAGAGG + Intronic
1109432154 13:62250176-62250198 TAGAATTTGGAGGAAAGAAGGGG - Intergenic
1110790640 13:79583003-79583025 TAGATTTTCCCAGAAAGGGGAGG - Intergenic
1112851910 13:103716426-103716448 TGAATTTTGAAGGAAGGTGGAGG + Intergenic
1112918654 13:104582191-104582213 TAGATTTGGAAGGGAAGGAGGGG - Intergenic
1113646026 13:111996551-111996573 GAGATTTGGAAGGAAATGGGAGG - Intergenic
1114881680 14:26793982-26794004 TAGAGATCGAAGGGAAGGGGTGG + Intergenic
1115613678 14:35072850-35072872 TAGATATGAAAGGAAAGGGGGGG - Intronic
1116061152 14:39925625-39925647 TATATTCTGTAGGAAAAGGGAGG + Intergenic
1116787829 14:49307679-49307701 TAAGTTTTCCAGGAAAGGGGTGG + Intergenic
1117844962 14:59901149-59901171 TAGGTTGTGAAGGGAAGGGAAGG - Intergenic
1118682011 14:68251471-68251493 AAGCTTTTGAAGGAATGTGGAGG + Intronic
1119181530 14:72608580-72608602 TAGATTTTCTAGGAGAAGGGAGG - Intergenic
1120008197 14:79383891-79383913 TACATTATAAAGGAAAGGGAGGG - Intronic
1120079658 14:80201595-80201617 TAGAAATTGTAGGAATGGGGAGG + Intronic
1121088535 14:91165078-91165100 AAGAACTAGAAGGAAAGGGGAGG - Intronic
1121265792 14:92601761-92601783 GAGATTTTTAGGGGAAGGGGAGG - Intronic
1122668048 14:103347657-103347679 TAGCTTTTAAAGGAAAAGTGAGG - Intergenic
1122749724 14:103923872-103923894 TAGGTTTTGAAGGGAAGGCAAGG + Intronic
1123174371 14:106402385-106402407 TCAATTTTGAAGGAAAGGCAGGG + Intergenic
1123182586 14:106483320-106483342 TGAATTTTGAAGGAAAGGCAGGG + Intergenic
1202944317 14_KI270726v1_random:13409-13431 TGAATTTTGAAGGAAAGGCAGGG - Intergenic
1125365082 15:38904955-38904977 TAGGTTTTGAAGGTAGGAGGAGG + Intergenic
1125426502 15:39554545-39554567 AAGATTACGAAGGAAAGGTGAGG + Intergenic
1126344229 15:47675930-47675952 CAGAGTTTGATGGAATGGGGAGG + Intronic
1126644744 15:50863875-50863897 TATTTTTTAAAGGAAGGGGGAGG - Intergenic
1126789601 15:52209074-52209096 TAGCCTTTGAGGGAAATGGGTGG + Intronic
1127320988 15:57846184-57846206 TAGATTTTGGAGGAAAGATCGGG - Intergenic
1127471772 15:59296624-59296646 TTGATTTTGGAGGAAGGGTGAGG + Intronic
1127784545 15:62344208-62344230 TATATTTGGAAGGCAAGGAGAGG + Intergenic
1128182273 15:65614528-65614550 TACATTTCGAAGGAAAAGAGGGG - Intronic
1128348007 15:66866861-66866883 TGAATTTTCCAGGAAAGGGGTGG - Intergenic
1128575586 15:68772298-68772320 TGGCTTTTGAAGGAAATGTGAGG - Intergenic
1128610351 15:69067948-69067970 TGGATTTTGAAGGAAAGGGCAGG - Intergenic
1129648288 15:77459010-77459032 GAGATTTTCAAGGGAAGAGGTGG - Intronic
1129956135 15:79638373-79638395 TAGGTTTTGAAGGGAAGGCGAGG - Intergenic
1130044163 15:80431123-80431145 TTTATTTTGAGGGAATGGGGTGG - Intronic
1130171983 15:81523900-81523922 TAGGTTTTGTGAGAAAGGGGAGG - Intergenic
1130305575 15:82710317-82710339 CAGATTTTGTAGGAAAGGTGGGG - Intergenic
1130619370 15:85445979-85446001 TATATTTTTAAACAAAGGGGGGG - Intronic
1130680197 15:85989975-85989997 TAGAATTTGAATGAAAAGTGGGG + Intergenic
1132532155 16:457464-457486 TGGATTTTGCAGGGAAGGGCAGG + Intronic
1133673278 16:8045222-8045244 TGGGTTTTCCAGGAAAGGGGTGG - Intergenic
1133952287 16:10405838-10405860 TAGGTTTTGAAGGAAAGTCAAGG - Intronic
1135656844 16:24257307-24257329 TGGATTTCGAAGGGAGGGGGAGG + Intronic
1138336220 16:56255199-56255221 TAGATTTAGGAGAAAAGGGAGGG + Intronic
1139205374 16:65023631-65023653 AAGGTTTTCTAGGAAAGGGGTGG + Intronic
1139976476 16:70815417-70815439 TAGATTTTAAGAGAAGGGGGTGG - Intronic
1140261651 16:73385590-73385612 TAGGTTTTGAAGGGAAGGTGAGG + Intergenic
1145226334 17:21131304-21131326 TGAATTTTCTAGGAAAGGGGTGG + Intronic
1145869435 17:28261285-28261307 TAGGTTTTGAAGGGAAGGTGAGG - Intergenic
1146004249 17:29150825-29150847 GGGATTTTGAAGAAAATGGGCGG - Intronic
1146004662 17:29153805-29153827 GGGATTTTGAAGAAAATGGGCGG + Intronic
1146097045 17:29940500-29940522 TAGATTTTAAAAGAAATGGAAGG + Intronic
1146752435 17:35393842-35393864 TAGGTTTTGAAGGGAAGGCAAGG + Intergenic
1148515061 17:48209192-48209214 AAGTTTTTGATGGAAAGAGGAGG - Intronic
1149069181 17:52519332-52519354 AAGATTTAGAAGGACAGGGCCGG - Intergenic
1149640826 17:58201385-58201407 TAGGTTTTGAAGGGAAGGCAAGG + Intronic
1149661783 17:58337974-58337996 TAGGCTCTGAAGGAAAGGGCTGG - Intergenic
1149978366 17:61288896-61288918 TTGGTTTTGGAGGACAGGGGTGG + Intronic
1151979539 17:77500304-77500326 AAGATTTTGAAGGAAATGAGTGG + Exonic
1153909761 18:9696529-9696551 CAGGTTTTGAAGGGAAGGCGAGG - Intergenic
1154436103 18:14342552-14342574 TAGGTTTGGAAGGCAAGGCGAGG - Intergenic
1155720819 18:29009507-29009529 TAAGTTTTCCAGGAAAGGGGTGG + Intergenic
1156051875 18:32946337-32946359 GAGAGTTTGAAGAAAAGTGGTGG - Intronic
1157633373 18:49123715-49123737 ATGTTTTTGAAGCAAAGGGGAGG + Intronic
1158135212 18:54200651-54200673 TAGCTTTTGAAGCAAAGGTTTGG + Intronic
1158628595 18:59092675-59092697 TAGATTCTGAAGGCACAGGGTGG + Intergenic
1159243196 18:65770305-65770327 TAGATTTTGTAGGCAATGTGGGG - Intronic
1160095501 18:75868344-75868366 CAGCTTTTGAAGGACAGGGTTGG + Intergenic
1160705982 19:530578-530600 TAGGTTTTGAAAGGAAGGGGAGG - Intergenic
1163853935 19:19684570-19684592 GAGATTTGGAGGGATAGGGGTGG - Intergenic
1164421174 19:28094220-28094242 TAGATTTTCTAGGAAAAAGGTGG - Intergenic
1165570618 19:36772018-36772040 TAGATTTTGAAGGGAAGGCGAGG - Intronic
1166669729 19:44702612-44702634 TTGGTTGAGAAGGAAAGGGGTGG + Intronic
1166957229 19:46472639-46472661 TAGGTTTTGGAGGGAAGGTGAGG - Intergenic
1167232482 19:48293792-48293814 TATCTTTGGAAGGAAAGAGGAGG + Intergenic
1167652755 19:50742040-50742062 TAGGTTTTGAAGGGAAGGCGAGG - Intergenic
1167811996 19:51841357-51841379 TAGGTTTTGAAGGGAAGGCAAGG - Intergenic
1168558356 19:57362437-57362459 TAGGTTTTGAAGGGAAGGCGAGG - Intergenic
926011735 2:9413909-9413931 TAGTTTTTTAAGAAATGGGGTGG - Intronic
926025805 2:9543529-9543551 TAGTTGTTGAAAGAAAGGGAAGG - Intronic
927825833 2:26309746-26309768 TAGCATTTGAAGGAAAAGTGTGG - Intronic
929063125 2:37943750-37943772 TTAATTTAGAAGGATAGGGGAGG - Intronic
929086701 2:38175141-38175163 AAGACCTTGAAGGAAAGGGAGGG + Intergenic
929475542 2:42243631-42243653 TAGATATTGAAGGAAAAGTTGGG - Intronic
930042619 2:47139822-47139844 GAGATTTAGAAGTAAATGGGTGG - Intronic
930248217 2:49006408-49006430 TAGATTTGGATGGATAGGGTTGG - Intronic
930431712 2:51285980-51286002 GAGATTTTGAAAGAATTGGGTGG - Intergenic
930625873 2:53697278-53697300 TGAATTTTCCAGGAAAGGGGTGG - Intronic
930994784 2:57703178-57703200 GAAAATTTGAAGGAAAGGAGAGG + Intergenic
932371260 2:71190089-71190111 TACCTTCTGAAGGAAAGAGGTGG - Intronic
932486766 2:72088861-72088883 TGGATTTTCTGGGAAAGGGGTGG - Intergenic
932573504 2:72950591-72950613 TAGTTTTTGGTGGACAGGGGAGG - Intronic
933407981 2:81886812-81886834 TAGGTTTTGAAAGAAAGGACTGG + Intergenic
934160862 2:89248424-89248446 TAGGTTTTGAAGGGAAGGGAAGG - Intergenic
934206414 2:89934009-89934031 TAGGTTTTGAAGGGAAGGGAAGG + Intergenic
934489893 2:94755278-94755300 TAGGTTTTGAAGGCAAGGCTAGG + Intergenic
935718238 2:105957701-105957723 TAGATTATATTGGAAAGGGGAGG - Intergenic
936107866 2:109640877-109640899 TCGATTTGGAAGGAAAGGCTGGG - Intergenic
936538202 2:113328676-113328698 CAGATCATGAAGGAAAGAGGAGG + Intergenic
937845731 2:126576823-126576845 TAGAGGTAGAAGGAAAGAGGTGG - Intergenic
938170875 2:129075639-129075661 TAGAGTTTGTAGGAAGGGGTAGG - Intergenic
940445451 2:153771640-153771662 AAGATTTTGTAGGAAAAAGGAGG + Intergenic
944658328 2:201898996-201899018 TAGAAATTGGTGGAAAGGGGAGG + Intergenic
944752033 2:202718846-202718868 CAGAATTTGAAGGACAGGGGAGG - Intronic
945458998 2:210082629-210082651 TGTATTTTGAAGCAAAGGGCAGG - Intronic
945904564 2:215577025-215577047 TATTTTTTGAGGGAAAGGAGAGG + Intergenic
947929653 2:233953019-233953041 GAGATTTTGAAGGAGAGGGTGGG - Intronic
947948967 2:234131277-234131299 TAGATTGTGAGGGAAGTGGGAGG + Intergenic
1169007862 20:2223835-2223857 TGAATTTTCCAGGAAAGGGGTGG - Intergenic
1170226114 20:13993819-13993841 TAGATTTTGAAAGAAAGGTGAGG - Intronic
1171074680 20:22110577-22110599 AAGATTTAGAAGGAGAGTGGGGG - Intergenic
1171879756 20:30610045-30610067 TACGTTTTGAAGGCAAGGCGAGG + Intergenic
1173886309 20:46462164-46462186 TTGGTTTTGAAGGGAAGGTGAGG - Intergenic
1173892401 20:46522926-46522948 TAGGTTTTGAAGGGAAGGCGAGG + Intergenic
1176840935 21:13843083-13843105 TAGGTTTGGAAGGCAAGGCGAGG + Intergenic
1177045823 21:16168480-16168502 CAGATATTGAAAGAAAGGGTAGG - Intergenic
1177650769 21:23959034-23959056 TAAATTTTGTGGGAAAAGGGAGG - Intergenic
1177864933 21:26500978-26501000 TAGATTTTCAAAGAAAAGGATGG + Intronic
1177910308 21:27022903-27022925 TAGATTTTGTTTGAAAGGAGGGG - Intergenic
1180242419 21:46519014-46519036 TAAATTTTCTGGGAAAGGGGTGG + Intronic
1181595612 22:23912644-23912666 TAGGTTTTGAAGGGAAGGTGAGG - Intergenic
1183503090 22:38192937-38192959 GAGCTTTAGAAGGCAAGGGGAGG + Intronic
1184497912 22:44853456-44853478 CAGATATTGGAGGAAAGGAGAGG + Intronic
1184559437 22:45253403-45253425 TAGGTTTTGAAGGAAAGGCAAGG + Intergenic
949436667 3:4037297-4037319 TAGAAGTTGAAGGAAGGAGGCGG - Intronic
949616036 3:5754712-5754734 TTGTTTCTGAAGGACAGGGGAGG + Intergenic
950149519 3:10675846-10675868 GAGATTGTGAAGAAAAGGGTGGG - Intronic
951060807 3:18204868-18204890 TAAATTTTTCAGGAATGGGGAGG + Intronic
951953773 3:28230956-28230978 TAGATTTCCAGGGTAAGGGGAGG - Intergenic
951990491 3:28671182-28671204 TAAATTCTGGAGGAAAGGGAAGG - Intergenic
952413746 3:33072121-33072143 TAGTATTTGAAGGGAAGGGAAGG - Intronic
953388929 3:42523347-42523369 TAGATGGTGAAGGAGAGGAGGGG - Intronic
954580371 3:51699962-51699984 TAGATCTGGAAGGTAAGGAGGGG + Intronic
955981386 3:64530952-64530974 TAGATTTTGGAGGGAAGGAATGG + Intronic
956975546 3:74574769-74574791 TAGATTTTTCAGGAAATGTGTGG - Intergenic
957772957 3:84717994-84718016 CAGGTTTTGAAAGAAATGGGAGG - Intergenic
959589061 3:108055930-108055952 TAGATATGGAAGGCATGGGGTGG + Intronic
960968738 3:123124164-123124186 GAGCTTTAGAAGGAAAGTGGGGG - Intronic
962729676 3:138268800-138268822 TAGATTCTGAACCAAAGTGGGGG + Intronic
963172645 3:142266565-142266587 TATTTTTTTAAGGAAAGAGGTGG + Intergenic
963622424 3:147627885-147627907 TACATATTTAAGGAAAGTGGAGG + Intergenic
963678256 3:148341767-148341789 TAGACTTTTAAGGAAAGGCTAGG - Intergenic
963912171 3:150824156-150824178 GAGATTAGGAAGGAAAGGTGGGG + Intergenic
963956505 3:151260296-151260318 TAGATTAAGAAGGAAATGAGAGG - Intronic
964334094 3:155636455-155636477 TAGATTTTGTAGGCCAGGCGCGG + Intronic
964630020 3:158800475-158800497 TAGATTTTGAATAGAAGAGGAGG + Intronic
965023945 3:163273783-163273805 TTGATATTGAAGGTAAGGAGTGG + Intergenic
966107423 3:176353465-176353487 ATGATTTTGAAAGAGAGGGGAGG + Intergenic
966619676 3:181950617-181950639 GAGACATTGAAGGAAAAGGGGGG - Intergenic
966947328 3:184786145-184786167 TGGAATTTGAAGTAAAGGAGAGG - Intergenic
967166945 3:186789140-186789162 TCGATTTGGGAGGAAAGGTGTGG + Exonic
969357116 4:6635164-6635186 GAGATGTTGATGGGAAGGGGAGG - Intergenic
969424998 4:7118998-7119020 TAGACATTGAAAGAAAGGGAAGG - Intergenic
969883898 4:10198280-10198302 TAGATAGTGAAGGGAAGGGAAGG - Intergenic
969894784 4:10293259-10293281 TAGGTTTTGGAGGGAAGGTGAGG - Intergenic
970056723 4:11982114-11982136 AAGGATTTGAAGGAAAGGTGAGG - Intergenic
971132040 4:23822292-23822314 CAGATTTTGAAGCGTAGGGGTGG - Intronic
971432681 4:26584528-26584550 TAGATTTTTAAAGAAGGGTGGGG + Intronic
971444930 4:26732977-26732999 GAAATTTTGAAAGAATGGGGTGG + Intronic
971548690 4:27921109-27921131 TAGGTTTTGAAGGGAAGGCAAGG + Intergenic
973282658 4:48376155-48376177 TAGAATATGAAGGAAGGGGCTGG + Intronic
973963802 4:56139521-56139543 TAGATAGTGAAAGAAAGAGGAGG + Intergenic
974530856 4:63106365-63106387 TAGGTTTTGAAGGGAAGGTGAGG - Intergenic
975894963 4:79078267-79078289 TAGGTTTTGAAGGGAAGGCGAGG + Intergenic
976059761 4:81113365-81113387 TAGAATTTGAAAAAAAAGGGGGG - Intronic
977756398 4:100676801-100676823 TAGGTTTTGAAGGGAAGACGAGG - Intronic
978327621 4:107576904-107576926 CATATTTGGAAGGAATGGGGTGG - Intergenic
978823887 4:112997409-112997431 TAGTTTTTGGAGGATAGAGGAGG - Intronic
979515001 4:121597629-121597651 TACATTTTGTTGGAAAAGGGTGG - Intergenic
979751329 4:124282665-124282687 TTTATTTTCAAGGAAAGGTGGGG - Intergenic
980119392 4:128712177-128712199 TAGAACTTGAAGGAATGGGTTGG - Intergenic
981711035 4:147709231-147709253 TAAATTTTCCGGGAAAGGGGTGG - Intergenic
982238931 4:153279069-153279091 GACATTTTGGAGGAATGGGGTGG + Intronic
983093613 4:163536811-163536833 TACCTTGTGAAGGAAAGTGGAGG - Intronic
983104311 4:163667181-163667203 TAGATTCAGGAGGAAAGGTGAGG + Intronic
983780421 4:171663462-171663484 TAGGTGTGGAAGGCAAGGGGAGG + Intergenic
984210506 4:176841339-176841361 TATACTGTGAAGGAATGGGGAGG + Intergenic
984315391 4:178123363-178123385 AAAATTTTGAAAGACAGGGGAGG + Intergenic
984390421 4:179124208-179124230 TGAATTTTACAGGAAAGGGGTGG + Intergenic
984414744 4:179443932-179443954 GAGATTTTGAAGGAAATAGAAGG - Intergenic
984697019 4:182789310-182789332 TAGATTATGACGGACAGGGGAGG + Exonic
985397299 4:189557749-189557771 CAGGTGTTGTAGGAAAGGGGTGG - Intergenic
986793104 5:11182426-11182448 TAGTTTTTGGAGGAGAGGGATGG + Intronic
988678121 5:33455308-33455330 CAGGTTTTAAAGGAGAGGGGAGG - Intronic
989156946 5:38353308-38353330 TTGATTTTGAATGGAAGCGGTGG + Intronic
989605911 5:43244298-43244320 TCCATTTTGAAGGAGAGAGGAGG + Intronic
990237306 5:53781986-53782008 TAGATTTAGAAATAAAGCGGTGG - Intergenic
990755056 5:59059353-59059375 GAGATTTGAAAGGAAAGAGGTGG - Intronic
990974309 5:61544318-61544340 TAGATCTTGTATGAATGGGGTGG + Exonic
991015534 5:61928127-61928149 TAGTTTTAGAATAAAAGGGGTGG - Intergenic
991676151 5:69091708-69091730 TAGGTTTTGAAGGGAACAGGAGG - Intergenic
993315833 5:86404911-86404933 AATATATGGAAGGAAAGGGGAGG + Intergenic
993830635 5:92753407-92753429 AAGATCTTGAAAGAAAGGGCTGG + Intergenic
994240240 5:97410895-97410917 CAGATTTTGAACGGAAGAGGTGG - Intergenic
994559535 5:101349533-101349555 TACATATAGAAGTAAAGGGGTGG + Intergenic
995300105 5:110570002-110570024 AAGATTTTGAAAGGAAGAGGAGG + Intronic
996561808 5:124837989-124838011 TAGACTTTGGGGGAAAGGGTGGG + Intergenic
997207346 5:132057485-132057507 TTTATTTTGAAGGAAAGAGGGGG - Intergenic
997575465 5:134972858-134972880 TGGATTTTAAAGGAAAGAGGGGG + Intronic
999210977 5:149888001-149888023 TAGGTTTTGAAGGGAAGGCGAGG - Intronic
999360953 5:150986470-150986492 TAGGTTTTGACGGGAAGGCGAGG + Intergenic
999362038 5:150993365-150993387 TAGGTTTTGAAGGGAAGGTGAGG + Intergenic
1000018017 5:157295472-157295494 TAGAATTAGAAGGAAGGGGGAGG - Intronic
1000325243 5:160167084-160167106 ATGATTTTTCAGGAAAGGGGTGG + Intergenic
1001547808 5:172581340-172581362 CAGATTTGGAAGAACAGGGGAGG - Intergenic
1004395913 6:15246202-15246224 TAGTTTTTGGAGGAAAAAGGGGG + Intergenic
1004875246 6:19944749-19944771 TTGGTTTTGAGGAAAAGGGGTGG - Intergenic
1006204894 6:32331869-32331891 TAGGTTTTGGAGGGAAGGCGAGG - Intronic
1006694842 6:35922158-35922180 TAGGTTTTGAAGGGAAGGTGAGG + Intergenic
1007624823 6:43239366-43239388 GAGTCCTTGAAGGAAAGGGGAGG + Intergenic
1007904646 6:45447129-45447151 TAGGTTTTGGAAGATAGGGGAGG + Intronic
1008222051 6:48866627-48866649 TGCATTTTGAAGGAAAGCAGAGG + Intergenic
1010809380 6:80281599-80281621 TTGACTTTCAAGGAAAGGAGAGG + Intronic
1011028415 6:82894602-82894624 TAAGTTTTGAAGGGAAGGTGAGG - Intronic
1011068216 6:83352723-83352745 AAGATTTTGTAGGAAATGGGAGG - Intronic
1011222107 6:85065551-85065573 TAAAATCTGAAGGAAAGGGAGGG + Intergenic
1012137789 6:95580014-95580036 CTGATCTTGCAGGAAAGGGGTGG - Intronic
1013387262 6:109643862-109643884 TAGACCTTGAAGACAAGGGGAGG - Intronic
1013618030 6:111862866-111862888 TAGAATTCTAAGGAAAGGGAAGG + Intronic
1014132421 6:117849445-117849467 TATATTTAAAAAGAAAGGGGAGG - Intergenic
1014486649 6:122007424-122007446 TTCATTTTGAAAGAAAGGGAAGG + Intergenic
1015483810 6:133745765-133745787 TACATTTTGAATGCAAGGGTAGG + Intergenic
1015968726 6:138721910-138721932 TAAATTCAGAAGGAAAGGGGTGG - Intergenic
1016686406 6:146887282-146887304 TAAGTTTTCCAGGAAAGGGGTGG + Intergenic
1016830607 6:148429886-148429908 TAGATTTTGATGGATTGTGGTGG + Intronic
1018772718 6:166986184-166986206 TAGATAGTGAAGGAACTGGGTGG - Intergenic
1018792826 6:167162527-167162549 TAGATTTTGAAGGAAAGGGGAGG + Intronic
1019029797 6:169000395-169000417 TAAATTCTGAAGGAAGAGGGTGG - Intergenic
1020053926 7:5103755-5103777 AGGATTTTGTAGGAAATGGGAGG - Intergenic
1020526782 7:9271973-9271995 TAGATTTTGATGGAAATTTGTGG - Intergenic
1021899919 7:25275183-25275205 TACAAGTTGAAGGAAAGAGGGGG - Intergenic
1021960889 7:25871959-25871981 GAGAATTTGAAAGAAAGGGGAGG + Intergenic
1022085866 7:27066912-27066934 TAGGTTTTTAAGAACAGGGGTGG + Intergenic
1022351325 7:29567993-29568015 AAGCTTTTAAAGCAAAGGGGTGG - Intergenic
1022864779 7:34406264-34406286 TAGATTTTTAAGGAAGAAGGAGG + Intergenic
1024932797 7:54681264-54681286 TGGATTTTGGAGGGAATGGGAGG - Intergenic
1027221538 7:76217206-76217228 TAGGTTTTGAAGGGAAGGCGAGG + Intronic
1027425957 7:78061720-78061742 GAGATCCTGAAGGAAAGGGTGGG + Intronic
1028709711 7:93893030-93893052 AATATTTTGAAGGAACTGGGAGG - Intronic
1028729720 7:94131828-94131850 TGGATTTTGTATGGAAGGGGTGG + Intergenic
1029187815 7:98752193-98752215 TAGGTTTTGAAGGGAAGGTGAGG + Intergenic
1029746696 7:102519373-102519395 TATTTTTTGTAGCAAAGGGGGGG - Intergenic
1030773426 7:113503373-113503395 TAGTTTTTGAAGGACAGGTTAGG + Intergenic
1030838431 7:114317707-114317729 TAGATCCTGAAGCAAAGGGAGGG - Intronic
1031354847 7:120778126-120778148 TTGATTGTGTAGGAAAGGGAGGG + Intergenic
1032364228 7:131284515-131284537 TAGATGTTTGAGGAAAGGGTGGG + Intronic
1033672511 7:143506460-143506482 TTGATTTTGAAAGAAAGTGAAGG + Intergenic
1035408262 7:158615614-158615636 TAGATTGTATAGGAAAGGAGGGG - Intergenic
1035955416 8:4072298-4072320 TACATTTTGAAGGCAAAGGAAGG - Intronic
1036673155 8:10806587-10806609 TCGTTATTGAAGGAAAGGAGTGG - Intronic
1036747127 8:11417809-11417831 TGGATTTTCTGGGAAAGGGGTGG + Intronic
1037405786 8:18541058-18541080 TAGATTTTGATGGCCAGGGAAGG - Intronic
1037577459 8:20221253-20221275 CAGATGCTGAAGGCAAGGGGAGG + Exonic
1037649076 8:20820295-20820317 TAAGTTTTCCAGGAAAGGGGTGG + Intergenic
1039714787 8:40095760-40095782 TTGATTTTGAGGGAAGGGTGAGG - Intergenic
1040571677 8:48616867-48616889 AGGATTTGGAAGGAAAGAGGAGG + Intergenic
1041215138 8:55592905-55592927 TTGTTTTTGAAGTAAAGGTGCGG - Intergenic
1041619136 8:59944871-59944893 TAGATTTAGAAGATAAGAGGGGG - Intergenic
1042205742 8:66327946-66327968 TAGGTTTTGAAGGGAAGGCGAGG - Intergenic
1046001883 8:108431608-108431630 TAAAATTTTAAGGAAAAGGGTGG - Intronic
1046448559 8:114358091-114358113 CAGATTGTGGAGGAAAGTGGGGG + Intergenic
1046968554 8:120194397-120194419 TAGATTTTGGGGGTAAGGGGGGG - Intronic
1048071556 8:131027154-131027176 TAGGTGTTTAAGGAAAGGAGGGG - Intronic
1048288604 8:133162511-133162533 TAGAGTTGGAATGAAAGGGAGGG - Intergenic
1049954116 9:675881-675903 TGTGTTTTGCAGGAAAGGGGTGG + Intronic
1050424668 9:5501022-5501044 TAGGTTTTGAAGGGAAGGCGAGG - Intergenic
1050994671 9:12201079-12201101 TAGAGTTTCTAGGAAAGGGATGG - Intergenic
1052026442 9:23578107-23578129 TAGCTTTTGGAGGAGAGGGGAGG - Intergenic
1052030333 9:23621265-23621287 TCTATTTTGAGGCAAAGGGGAGG + Intergenic
1052384112 9:27805170-27805192 TAGGTTTTGAAGGGAAGGTGAGG + Intergenic
1053190293 9:36060264-36060286 TAGGTGTTGAAGGGAAGGAGAGG - Intronic
1053667898 9:40329247-40329269 TAGATTTTGAAGGCAAGGCAAGG - Intergenic
1053917704 9:42955534-42955556 TAGATTTTGAAGGCAAGGCGAGG - Intergenic
1054379043 9:64469286-64469308 TAGATTTTGAAGGCAAGGCAAGG - Intergenic
1054516713 9:66047036-66047058 TAGATTTTGAAGGCAAGGCAAGG + Intergenic
1055496094 9:76857215-76857237 TACATTTTGATGGATGGGGGTGG - Intronic
1055530460 9:77177995-77178017 TATATTTTGGGGGAAAGGAGAGG + Intronic
1056888666 9:90468931-90468953 TAGATTTTGAAAGGAAGTGAGGG + Intergenic
1058554945 9:106157252-106157274 AAGATCTTGAAGGGAAGGGAAGG - Intergenic
1059369526 9:113815879-113815901 TAAATATTGAAAGAAAGGGCAGG + Intergenic
1060556691 9:124511656-124511678 TAGAGCTTGAAGGAAAGGACAGG - Intergenic
1061700013 9:132408909-132408931 TAGATTTTGAAGGGAAGGGGAGG - Intergenic
1185664322 X:1752665-1752687 TAAATTCTGAAGTAAAGGGTTGG + Intergenic
1185859748 X:3566522-3566544 GAGGTTTTTCAGGAAAGGGGTGG + Intergenic
1186056069 X:5650911-5650933 TAAATTTTCCAGGAAAGGGGTGG + Intergenic
1186271363 X:7891875-7891897 TAGGTTTTGAAGGGAAGGTGAGG + Intergenic
1186953866 X:14658594-14658616 TAGATTTGGAAAGAAAAAGGAGG - Intronic
1187217027 X:17287115-17287137 AAGATTTTCCAGGAAAGGAGAGG - Intergenic
1187406924 X:19012807-19012829 TAGAATTTGGAGGATGGGGGAGG - Intronic
1188309163 X:28596387-28596409 TAGAGGTGGAAGGAAGGGGGAGG - Intronic
1188831424 X:34902599-34902621 TAGATTCTGCAGGGACGGGGAGG + Intergenic
1188941049 X:36237982-36238004 TTGATTTTGAAGGTAAGAGATGG - Intronic
1190362674 X:49663826-49663848 GAAATTTGAAAGGAAAGGGGAGG - Intergenic
1190677828 X:52797241-52797263 TAGGTTTTGAAGTGAAGGCGAGG - Intronic
1190773056 X:53531150-53531172 TAAATTTGAAAGTAAAGGGGGGG - Intergenic
1190930461 X:54945227-54945249 TAGCTTTTAAAAGAAAGGGATGG + Intronic
1191007700 X:55728003-55728025 TATATTTTGAAAGAAAGATGGGG + Intronic
1191640904 X:63429129-63429151 TCCATTTTGTTGGAAAGGGGAGG + Intergenic
1193560640 X:83012569-83012591 TAGAAATTGAAGGAAGGAGGTGG - Intergenic
1194047272 X:89024033-89024055 TAGGTTTTGAAGGGAAGATGAGG + Intergenic
1194141470 X:90215626-90215648 TAGGTTTTGAAGGGAAGGTGAGG + Intergenic
1194142606 X:90223268-90223290 TAGGTTTTGAAGGGAAGGTGAGG + Intergenic
1194371184 X:93074031-93074053 TATATTTTGAAAGAAAGAGATGG + Intergenic
1194895214 X:99432140-99432162 TATATTTTAAAGGAAAGCAGAGG + Intergenic
1194966914 X:100298677-100298699 GAGAGTTTGCAGGGAAGGGGCGG - Intronic
1195424473 X:104712870-104712892 TAGATTTTGACTGAAACAGGAGG + Intronic
1195982163 X:110590849-110590871 AAGATTTTAAAGAAAAAGGGAGG - Intergenic
1197752055 X:129971511-129971533 TAGTTCTTTAAGGAAAGAGGTGG + Intergenic
1197909793 X:131469006-131469028 CAGGCTTTGGAGGAAAGGGGTGG - Intergenic
1198392085 X:136186435-136186457 TTGATTTACAAGGAAAGGGAGGG - Intronic
1199033304 X:143026103-143026125 TAGGTTTTGAAGGGAAGGTGAGG + Intronic
1199034422 X:143033396-143033418 TAGGTTTTGAAGGGAAGGCAAGG + Intronic
1199073996 X:143509864-143509886 TAGGTTTTGAAGGGAAGATGAGG - Intronic
1199075164 X:143517281-143517303 CAGGTTTTGAAGGGAAGGTGAGG - Intronic
1199092996 X:143713108-143713130 TAGGTTTTGAAGGGAAGGCAAGG - Intronic
1199094155 X:143720558-143720580 TAGGTTTTGAAGGGAAGGTGAGG - Intronic
1199214189 X:145247672-145247694 TAGGTTTTGAAGGGAAGGTGAGG + Intronic
1199329612 X:146543409-146543431 TACATTTAAAAGGAAAGGAGAGG - Intergenic
1200257272 X:154590118-154590140 TAGATTGTGAAGAAGAGGCGGGG + Intergenic
1200260498 X:154614284-154614306 TAGATTGTGAAGAAGAGGCGGGG - Intergenic
1200487223 Y:3784730-3784752 TAGGTTTTGAAGGGAAGGTGAGG + Intergenic
1200488362 Y:3792369-3792391 TAGGTTTTGAAGGGAAGGTGAGG + Intergenic
1201365755 Y:13204741-13204763 GAGAACTGGAAGGAAAGGGGAGG - Intergenic