ID: 1018793167

View in Genome Browser
Species Human (GRCh38)
Location 6:167165531-167165553
Sequence CTGTCTTTGCTGATGGAAGC TGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 393
Summary {0: 1, 1: 1, 2: 0, 3: 25, 4: 366}

Found 3 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1018793167_1018793177 25 Left 1018793167 6:167165531-167165553 CCAGCTTCCATCAGCAAAGACAG 0: 1
1: 1
2: 0
3: 25
4: 366
Right 1018793177 6:167165579-167165601 CCCCTCTCTCCTGTAGACGGAGG No data
1018793167_1018793174 22 Left 1018793167 6:167165531-167165553 CCAGCTTCCATCAGCAAAGACAG 0: 1
1: 1
2: 0
3: 25
4: 366
Right 1018793174 6:167165576-167165598 AGCCCCCTCTCTCCTGTAGACGG 0: 1
1: 0
2: 1
3: 7
4: 150
1018793167_1018793171 -6 Left 1018793167 6:167165531-167165553 CCAGCTTCCATCAGCAAAGACAG 0: 1
1: 1
2: 0
3: 25
4: 366
Right 1018793171 6:167165548-167165570 AGACAGGAGGAAGCCAAGTCAGG 0: 1
1: 0
2: 1
3: 31
4: 357

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1018793167 Original CRISPR CTGTCTTTGCTGATGGAAGC TGG (reversed) Intronic
900682856 1:3926407-3926429 CTGGCTTTGCAGATGGAGGAAGG - Intergenic
900706726 1:4085476-4085498 TTTTCTTTGCTGATTGGAGCAGG + Intergenic
900961234 1:5922133-5922155 CTGCCTTTGAAGATGGAAGAAGG + Intronic
901028092 1:6289877-6289899 CTGTCTTAGCAGGTGGAAGGGGG - Intronic
901480340 1:9520676-9520698 CTGTCATTGCTGTTGGGATCTGG - Intergenic
901644152 1:10707619-10707641 GTGTCCTGGCTGATGGGAGCAGG + Intronic
903688746 1:25153931-25153953 CTGGCTTTGAAGATGGAAGAGGG - Intergenic
904096024 1:27978069-27978091 CTGTCTTTGAAGATGGAAGATGG + Intronic
904197805 1:28798986-28799008 CTGTCTTAACAGATGGCAGCAGG - Intergenic
905413662 1:37790083-37790105 CTGGCTTTGAAGATGGAAGAAGG + Intergenic
905992435 1:42350295-42350317 CTGGCTTTGAAGATGGAAGTGGG - Intergenic
906311414 1:44757221-44757243 GTGTCTCTTCTGCTGGAAGCTGG + Intronic
906492998 1:46282562-46282584 GTGCCTTTACTGATGTAAGCTGG - Intronic
907548661 1:55285531-55285553 CTGGCTTTGAAGATGGAAGAAGG + Intergenic
908267680 1:62395117-62395139 CTGTCTTCCCTGATGGAGACAGG + Intergenic
908965954 1:69763278-69763300 CTGACTTTTCTCATGGTAGCAGG + Intronic
910766787 1:90790080-90790102 CTGGCTTTGAGGATGGAAGGGGG + Intergenic
910818893 1:91324760-91324782 CTGTCTTTTCTTACAGAAGCAGG - Exonic
911381272 1:97118180-97118202 CTGACCTTGCTGATGCAAGGGGG + Intronic
912698889 1:111861556-111861578 CTGTGTTTACGGAGGGAAGCGGG + Intronic
913478283 1:119260162-119260184 CTGCCCTTGCTGAAGGAAGGGGG - Intergenic
915001134 1:152592980-152593002 CTTTTTTTGCTGATGTAAGTGGG + Intronic
915213520 1:154326210-154326232 CTGTCCTTGGTGAGGGAAGGTGG + Intronic
915735310 1:158080884-158080906 CAGCCTTTGCTCATGGCAGCTGG + Intronic
916474255 1:165153570-165153592 CTGTCTTGGCTCAGGCAAGCAGG + Intergenic
916744300 1:167672539-167672561 CTGTCTTTGAAGATGGAGGAAGG - Intronic
918333796 1:183487267-183487289 CTGGCTTTGAAGATGGAAGGGGG - Intronic
918399228 1:184146967-184146989 CTAGCTTTGCTGATGGAGGAAGG - Intergenic
918405116 1:184204478-184204500 CTGGCTTTGAAGATGGAAGAAGG + Intergenic
918593698 1:186268800-186268822 CTGTCTTTACTGCTGGTTGCGGG - Intergenic
919500863 1:198336768-198336790 CTGGCTTTGAAGATGGAAGAAGG - Intergenic
920165651 1:204033857-204033879 CTGGCTTTGCAGATGTAAGGAGG - Intergenic
922247559 1:223815508-223815530 CTCTCTTTGCTCCTGGAACCTGG - Intronic
923038166 1:230300180-230300202 CTGGCTTTGATGATGGATGGGGG - Intergenic
923338164 1:232987280-232987302 GTGTCCATGCTGCTGGAAGCAGG + Intronic
923999520 1:239535151-239535173 CAGTGTTTGCTGAAGGAAGGGGG + Intronic
924587836 1:245375516-245375538 TTGGCTTTGATGATGGAAGAAGG + Intronic
1063647970 10:7904837-7904859 CTGGCTGAGCTCATGGAAGCTGG + Intronic
1063665392 10:8057757-8057779 CTGTATTTGGTGCTGGGAGCTGG + Intronic
1066681380 10:37939231-37939253 CTGTATGTTCTGGTGGAAGCAGG - Intergenic
1066731602 10:38441735-38441757 CTGGCTTTGAAGATGGAATCAGG + Intergenic
1067222637 10:44355180-44355202 CGGTTTCTGCTGATGGAGGCTGG - Intergenic
1068098084 10:52516982-52517004 TTGTTTTTGCTGATGAAAGTAGG - Intergenic
1068105955 10:52616622-52616644 CTGGCTTTGAAGATGGAAGAGGG - Intergenic
1068988698 10:63130067-63130089 CTGGCTTTGAAGATGGAAGAAGG + Intergenic
1069086573 10:64146843-64146865 CTGACTTTGCAGATGGAGGAAGG + Intergenic
1070150818 10:73803806-73803828 AAGTCTGTGCTGAGGGAAGCTGG + Intronic
1070629453 10:78074568-78074590 CTGGCTTTGAAGATGGAAGAGGG + Intergenic
1070658744 10:78289710-78289732 CTGTGTGTGCTGGTGGGAGCTGG + Intergenic
1071805616 10:89117279-89117301 CTGACTTTGAAGATGGAAGAAGG + Intergenic
1071976051 10:90956477-90956499 CTGGCTTTGAGGATGGAAGAAGG + Intergenic
1072725197 10:97808423-97808445 CTTTCTTTCCTGATGGAGTCTGG + Intergenic
1072911889 10:99509497-99509519 CTGGCTTTGAAGATGGAGGCAGG + Intergenic
1073741301 10:106410172-106410194 CTGTTTTTGAAGATGGAAGCGGG + Intergenic
1073774128 10:106767172-106767194 CAGGCTTTGCTGATGAAGGCTGG + Intronic
1073839485 10:107482152-107482174 CTGTCTTTGCAGATGAACGGAGG - Intergenic
1074414277 10:113253550-113253572 CTGGCTTTGAAGATGGAAGGTGG - Intergenic
1076431844 10:130409548-130409570 CCGTCCCTGCTGCTGGAAGCTGG - Intergenic
1077488187 11:2848591-2848613 CTGTCCCTCCTGCTGGAAGCTGG - Exonic
1077928103 11:6702546-6702568 CTGGCTTTGAAGATGGAAGGGGG + Intergenic
1078267901 11:9768664-9768686 CTGGCTTTGAAGATGGAAGGGGG - Intergenic
1078508884 11:11970751-11970773 CTGGCTTTGTAGATGGAAGGGGG + Intronic
1078619899 11:12897629-12897651 CTGTCTTTGCCAAAGGAAACTGG - Intronic
1078928834 11:15897827-15897849 CTGGCTTTGATGAAGCAAGCTGG + Intergenic
1079326893 11:19501078-19501100 CTGACTTTGAAGATGGAAGGAGG - Intronic
1079412425 11:20201594-20201616 CAGTCTTTGCTGATGGCTGTGGG + Intergenic
1080042057 11:27769413-27769435 CTTTCTTTTCTAATGAAAGCAGG + Intergenic
1080228397 11:29987009-29987031 CTGGCTTTGAAGATGGAAGAAGG + Intergenic
1080578536 11:33622521-33622543 CTGCCTAGGCTGCTGGAAGCTGG - Intronic
1080963723 11:37190002-37190024 CTGGCTTTGAAGATGGAAGAAGG + Intergenic
1081757630 11:45555955-45555977 CTGGTCTTGCTGAGGGAAGCAGG - Intergenic
1083166476 11:60891140-60891162 CTGGCCCTTCTGATGGAAGCTGG - Exonic
1083580414 11:63821235-63821257 CTGGCTTTGAAGATGGAAGGAGG - Intronic
1084012506 11:66360492-66360514 GAGTGTTTGCTGATGGAAACTGG + Intronic
1084142322 11:67240787-67240809 CTGCCTTTTTTGATGAAAGCAGG + Intronic
1085275408 11:75295425-75295447 CTGCCTTTGAAGATAGAAGCAGG - Intronic
1085709869 11:78819611-78819633 CTGTCTTTGATGCTGGAGTCCGG - Intronic
1087463389 11:98473178-98473200 CTGGCTTTGATGATGGAGGAAGG - Intergenic
1088741378 11:112770173-112770195 CTGTCAGTGCTGCTGCAAGCAGG + Intergenic
1089900117 11:121973232-121973254 CTGGCTTTGAAGATGGAAGAAGG + Intergenic
1090630870 11:128646162-128646184 CTGTCAGTGCTCATGGAAACAGG + Intergenic
1090943282 11:131407747-131407769 CTGGCTTTGCAGCTGGAACCAGG + Intronic
1091184565 11:133636121-133636143 CTGACTTTGCAGAGTGAAGCTGG - Intergenic
1092001576 12:5036988-5037010 CTGGCTTTGATGATGGAGGAGGG + Intergenic
1093323226 12:17739891-17739913 CTGGCTTTGAAGATGGAAGGAGG - Intergenic
1094288441 12:28819103-28819125 CTGTCTTTGCAGATGGACAGAGG + Intergenic
1096543574 12:52322091-52322113 GTGTCATTGCTGATGGGATCAGG + Intergenic
1097411465 12:59258757-59258779 CTGACTCTGAAGATGGAAGCAGG + Intergenic
1099030474 12:77520145-77520167 CTGGCTTTGAAGATGGAAGAAGG - Intergenic
1100375452 12:94011744-94011766 CAGTCTTTGATGGTGGATGCAGG - Intergenic
1102191930 12:110995181-110995203 GTGTCTCTGCAAATGGAAGCAGG - Intergenic
1103050958 12:117779060-117779082 CTGTCTTTGCAGAGGGAAATTGG - Intronic
1103958025 12:124589700-124589722 CTGTCCTTGGTGATGGGAACTGG - Intergenic
1104069014 12:125328692-125328714 GGGTCTTTGATGATGTAAGCAGG - Intronic
1104646612 12:130502086-130502108 CTGTCTTGCCTGATGGAGGAGGG + Intronic
1106335764 13:28781762-28781784 CTGATTTTGCTGAGGGATGCTGG + Intergenic
1106406221 13:29476857-29476879 GTGCCCTTGCAGATGGAAGCAGG - Intronic
1106473301 13:30076947-30076969 CTGGCTTTGCAGATGGAGGAAGG - Intergenic
1106735373 13:32583674-32583696 CTGGCTTTGCGGATGGAGGAAGG + Intergenic
1106873280 13:34044619-34044641 CTGGCTTTGAAGATGGAAGAAGG + Intergenic
1107377269 13:39817621-39817643 CTTTCTTTGTTGGTGGTAGCAGG + Intergenic
1107539145 13:41369732-41369754 CTGGCTTTGAAGATGGAAGGAGG + Intronic
1107821643 13:44291279-44291301 CTGTCTTTGAGCATTGAAGCGGG - Intergenic
1110593633 13:77293745-77293767 CTGGCTTTGAAGATGGAAGGGGG + Intronic
1113781172 13:112978404-112978426 CTGTCTTTCCTGGCAGAAGCTGG + Intronic
1113829961 13:113287936-113287958 CTGAGTCTGCTGATGGAGGCTGG - Intergenic
1114722860 14:24900832-24900854 CTGTCTTTTCTAAAGGAACCAGG + Intronic
1115479241 14:33845319-33845341 CTGTGTTTGCCTCTGGAAGCTGG + Intergenic
1117692127 14:58318719-58318741 CTGGATTTGTTAATGGAAGCTGG - Exonic
1118081152 14:62362213-62362235 CTGTTCTTGAGGATGGAAGCTGG + Intergenic
1118118357 14:62806872-62806894 CTCTCTTTGCTGATGGCTGTGGG + Intronic
1118921098 14:70150676-70150698 CTCTCTTTGCAGAGGAAAGCAGG + Intronic
1119024193 14:71139660-71139682 CCCTCTGTGCGGATGGAAGCAGG - Intergenic
1119154075 14:72392464-72392486 ATGTCTGTGATGATGGGAGCCGG - Intronic
1119165314 14:72487614-72487636 CTGGCTTTGCAGATGGAAGGGGG + Intronic
1119790021 14:77341725-77341747 CTGTATTTGCTGGCTGAAGCAGG - Exonic
1119799371 14:77429208-77429230 CTGTGGTTGATGATGGAAACTGG - Intronic
1119858743 14:77921608-77921630 CTGTCTATGCTGGTGAAATCTGG + Intronic
1121145811 14:91581334-91581356 CTGTCTTTAATGGTGGAAGGAGG + Intronic
1121664344 14:95660542-95660564 CTCTTTTTGCTGAGGGAAGTGGG - Intergenic
1121947556 14:98137376-98137398 GTATATTTGCTGATGGAAGGGGG + Intergenic
1122297620 14:100714136-100714158 CTGTGGTTGCAGAGGGAAGCCGG - Intergenic
1123848262 15:24326665-24326687 CTGTCTTTGCCAGTGGAGGCTGG + Intergenic
1126367295 15:47908304-47908326 CTGCCTTTGCAGAGGGAAGCTGG + Intergenic
1126450587 15:48804163-48804185 CTGTATTTGCACATGGCAGCAGG - Intronic
1126780082 15:52132258-52132280 CTGTCATAGCTCATGGATGCTGG - Intronic
1127057008 15:55142395-55142417 CTGTCTATGCAGAAAGAAGCAGG + Intergenic
1127105940 15:55615127-55615149 CTGGCTTTGAAGATGGAAGGAGG + Exonic
1127306320 15:57709060-57709082 CTGTCTCTATTGCTGGAAGCTGG - Exonic
1128101966 15:65009514-65009536 CGGAATTTGCTGATGGAATCTGG - Intronic
1128242521 15:66110700-66110722 CTGTTTCTGGTGATGGCAGCAGG + Intronic
1129175548 15:73837498-73837520 GAGTCTATGCTGAGGGAAGCTGG + Intergenic
1129226116 15:74171388-74171410 TTGTCCTTCCTGGTGGAAGCGGG + Intergenic
1129525440 15:76210829-76210851 CACTCTTTGCTCAGGGAAGCAGG - Intronic
1130206770 15:81883555-81883577 ATGTCATTGCTGATGGTAGGTGG + Intergenic
1130893841 15:88155296-88155318 CTGGCTTTGAAGATGGAAGAGGG + Intronic
1133222823 16:4326484-4326506 GTCTCTTTGCAGAAGGAAGCGGG - Intronic
1133266728 16:4589271-4589293 ATGTCTTTTATGATGGAAGGTGG - Intronic
1133450993 16:5903909-5903931 CTGTCTTTGCTGAGGGAAGCTGG + Intergenic
1133472612 16:6090110-6090132 CTGGCTTTGAAGATGGAAGAAGG - Intronic
1134129240 16:11637459-11637481 CTGTTTCTGCTGCTGGCAGCTGG + Intergenic
1136920474 16:34266951-34266973 CTGTCTTTAGTCAAGGAAGCAGG + Intergenic
1138524031 16:57591516-57591538 CTGGCTTGGCTGCGGGAAGCTGG - Intronic
1139218114 16:65149389-65149411 CTGTATTTGGTGATAGATGCAGG + Intergenic
1139693586 16:68656964-68656986 AGGTCTTTGCTGCTGGAGGCAGG - Intronic
1140665422 16:77223031-77223053 ATGTCCTGGCAGATGGAAGCCGG - Intergenic
1140706969 16:77639851-77639873 CTGGCTTTGAAGATGGAAGAAGG + Intergenic
1140890037 16:79277233-79277255 CGGTCTTTGCAGATGTAATCAGG - Intergenic
1141547998 16:84785248-84785270 CTGTGTCTTCTGATGGAAACAGG - Intergenic
1142442104 16:90105573-90105595 CTGTCTGTGCTGGTGGCATCTGG - Intergenic
1146424347 17:32722470-32722492 CTGGCTTTGAAGATGGAAGGGGG - Intronic
1146573115 17:33969681-33969703 CTGTCATTGATGATGGGAGCTGG - Intronic
1146607515 17:34273709-34273731 GAGTCTTTGCTGATGGTATCTGG - Intergenic
1149227645 17:54493610-54493632 GTGTCTTTGATGATAGAAGCAGG + Intergenic
1149560903 17:57607368-57607390 CTGCCTTTCCCTATGGAAGCTGG + Intronic
1151550403 17:74819439-74819461 CTGTGTTTGCTGAAGAGAGCAGG + Intronic
1152559632 17:81071532-81071554 CTTTCTCTGCTGGTGGAAGAGGG - Intronic
1153164208 18:2243570-2243592 CTGGCTTTGAAGATGGAAGAGGG - Intergenic
1153304591 18:3620281-3620303 CTGGCTTTGCAGATGGAGGAAGG + Intronic
1155437024 18:25824192-25824214 CTGGCTTTGAAGATGGAGGCAGG - Intergenic
1156161891 18:34369605-34369627 CTGGCTTTGAAGATGGAAGAAGG + Intergenic
1156260849 18:35444022-35444044 CTGTCTTTGCTTATGTGTGCAGG - Exonic
1156943398 18:42796871-42796893 CTGTCTTTACTTAAGGAGGCAGG - Intronic
1156968863 18:43130801-43130823 TTGCCATTGCTGATGGAAGGGGG - Intergenic
1158135843 18:54207247-54207269 ATGTCTTTCCAGATGGAAGGAGG + Intronic
1159897514 18:74011436-74011458 CTGTCTCTGCTGATGGAGAATGG + Intergenic
1161806368 19:6445489-6445511 CTGGCTTTGAAGATGGAAGAAGG + Intronic
1161998094 19:7726794-7726816 CTGCCTTTGAAGATGGAAGAAGG + Intergenic
1163397774 19:17074265-17074287 CCGCCTTTGGTGATGGGAGCAGG - Intronic
1164157075 19:22603437-22603459 CTGGCTTTGCTGAAGGCAACTGG - Intergenic
1164251717 19:23483055-23483077 CTGTCTTTGCTGAGTCATGCAGG - Intergenic
1164952934 19:32353958-32353980 TTTTCTGTGCTGATGTAAGCAGG - Exonic
1166398401 19:42459550-42459572 CTGGCTTTGAAGATGGAAGGGGG + Intergenic
1166464903 19:43023510-43023532 CTGACTTTGATGGTTGAAGCAGG + Intronic
1167529041 19:50003385-50003407 CTGCCTTTGCAGATGAAAGGTGG - Intronic
1168014415 19:53560720-53560742 CAGGCTTTGCTGATGGAAGAAGG - Intronic
927305359 2:21565424-21565446 CTGTCTTTGGAAAAGGAAGCAGG - Intergenic
928883290 2:36121753-36121775 CTGTCTTTGCAGATGGAAAAGGG - Intergenic
929571502 2:43025892-43025914 CTGACTTTGAAGATGGAGGCAGG - Intergenic
930092850 2:47543956-47543978 CTGTCACTGCTCCTGGAAGCAGG + Intronic
930275712 2:49308797-49308819 CTGGCTTTGAAGATGGAAGAAGG + Intergenic
931090022 2:58875878-58875900 CTCACTTTTCTGCTGGAAGCAGG - Intergenic
931856458 2:66307014-66307036 CTGTCCTGGCTCATGTAAGCAGG + Intergenic
932415711 2:71572801-71572823 CTGTCGATGCTGATGGCAGCTGG + Intronic
932987235 2:76740751-76740773 AGGTCTTGGCTGTTGGAAGCAGG - Intergenic
935332369 2:101986397-101986419 ATGTCATTTCTGATGAAAGCTGG + Intergenic
936605715 2:113950911-113950933 CTGTCTTACATGATGGCAGCAGG + Intronic
936830007 2:116632437-116632459 CTGTCTTACATGATGGCAGCAGG + Intergenic
937091198 2:119207557-119207579 CTGACTTTGCTGCTGGGGGCGGG - Intergenic
937869866 2:126779125-126779147 ATGTCTCTGCTGATCAAAGCAGG + Intergenic
938725251 2:134103136-134103158 CTGTCTCTGCTGGGGGAGGCAGG - Intergenic
941551928 2:166927524-166927546 CTGGCTTTGAAGATGGAAGAAGG - Intronic
941646928 2:168050595-168050617 CTGGCTTTGCAGATGGCAGAAGG + Intronic
942817405 2:180068036-180068058 CTATAGTTGCTGATGGCAGCTGG + Intergenic
943319729 2:186432513-186432535 CTGTAATTGCTGATGGAGGGAGG - Intergenic
943538706 2:189184569-189184591 CTGGCTTTGCAGATGGAGGAAGG - Intergenic
944630852 2:201622558-201622580 CTGGCTTTGAAGATGGAAGAGGG - Exonic
945589464 2:211711887-211711909 CTGTCATTGCTGGTGAAATCAGG + Intronic
946425110 2:219590483-219590505 CTGGCTTTGGAGATGGAAGGGGG + Intergenic
946797121 2:223366927-223366949 CTGTATTTTCTGATGTAGGCGGG + Intergenic
946889533 2:224260904-224260926 CTGCATTTGCTGGTGGAAGTAGG - Intergenic
947094329 2:226548979-226549001 CTGGCTTTGAAGATGGAAGGGGG - Intergenic
948224921 2:236301362-236301384 CTGTCTTTGCTTAGGTAACCAGG - Intergenic
948408058 2:237737519-237737541 CTGCTTTTGCTTAGGGAAGCTGG + Intronic
948439776 2:237979238-237979260 TTGTTTTGGCTGATGGGAGCTGG + Intronic
1169133421 20:3180425-3180447 CTGGCTTTGCAGATGGAAGAAGG + Intergenic
1171462174 20:25304274-25304296 CTGTCTGTGCTGCTGGCAGGAGG + Intronic
1173338823 20:42136067-42136089 CTATCTTTGGTGATGGAGGGAGG - Intronic
1173932081 20:46829254-46829276 CTGGCTTTGAAGATGGAAGCAGG + Intergenic
1174142896 20:48429021-48429043 CTGGCTTTGAGGATGGAAGGAGG - Intergenic
1174830920 20:53811543-53811565 GTGTCTTTGCACATGTAAGCAGG - Intergenic
1175202063 20:57284852-57284874 CAGTCTCTGGTGATGGAAGCAGG - Intergenic
1175691491 20:61068731-61068753 CTGGCTTTGAGGATGGAAGAAGG - Intergenic
1175757981 20:61541915-61541937 CTCTGTTTGCTGCTTGAAGCTGG + Intronic
1178704835 21:34864574-34864596 CTGTGTGTGCTGCTGGAAGTCGG + Intronic
1178804101 21:35824162-35824184 CTGGCTTTGCAGATGGAGGAAGG + Intronic
1179140070 21:38717577-38717599 CTGGCTTTGAGGATGGAAGACGG + Intergenic
1179178298 21:39024264-39024286 GGGTCTTTGCAGATGTAAGCAGG - Intergenic
1180883561 22:19223838-19223860 CTGCCCTTGCTGATGGCAGGTGG - Intronic
1181523237 22:23461041-23461063 TTCCCTTTGCTGATGGAACCCGG + Intergenic
1182683525 22:32102077-32102099 CTGAGTTTGCTTATGGAACCGGG + Exonic
1184277373 22:43417730-43417752 CTGCCTTTGCTGAGCCAAGCCGG + Intronic
1184422190 22:44388764-44388786 CTGGCTTTGGAGATGGAAGAAGG + Intergenic
949708170 3:6842661-6842683 CTTTCTTTGCTGGTGGAGCCTGG - Intronic
950381415 3:12618860-12618882 TTTTCTTTGCTGATGAATGCAGG - Intronic
952755727 3:36864883-36864905 CAGTCTTTGCTGATGTTGGCTGG - Intronic
952853557 3:37749213-37749235 CTGGCTTTGAAGATGGAAGGGGG - Intronic
953529203 3:43724484-43724506 ATGTCTTTGCATATTGAAGCTGG - Intronic
954665462 3:52249087-52249109 CTTTCTGGGCAGATGGAAGCTGG - Intronic
955235319 3:57134239-57134261 CTGGATCTGCTGATGGAAGTTGG - Intronic
955385264 3:58474358-58474380 TTTTCTTTGCTGATAGAACCTGG - Intergenic
955979426 3:64509800-64509822 CTGGCTTTGCAGATAGAAGAAGG + Intergenic
956110577 3:65866531-65866553 CTTTCTGTGCTGGTGGGAGCAGG - Intronic
956221397 3:66907666-66907688 CTGTAATTGCTGAGGGAACCAGG - Intergenic
959029522 3:101281818-101281840 CTGTCTTTGAAGATGGAAGTGGG + Intronic
959123069 3:102255937-102255959 CTGGCTTTGAAGATGGAAGGAGG + Intronic
959134130 3:102395451-102395473 CTGGCTTTGATGATGGAAAGGGG + Intronic
960305396 3:116054154-116054176 CTGGCTTTGAAGATGGAAGGTGG - Intronic
960386581 3:117028079-117028101 CACTCTTTGCTGATGGCTGCGGG + Intronic
960636948 3:119793551-119793573 CTGGCTTTGAAGATGGAAGAAGG - Intronic
961152254 3:124648780-124648802 CTGTCTCTGGTGATGGCACCAGG + Intronic
961981345 3:131082466-131082488 CTTTCTGTGCTGATGGAAATGGG + Intronic
963044370 3:141091931-141091953 CAGGCTTTGCTGAAGGGAGCTGG - Intronic
964323623 3:155523576-155523598 CTGTCTTTGATAATAAAAGCTGG - Intronic
966920945 3:184610938-184610960 ATGTCTTAGCTGAGAGAAGCGGG - Intronic
968476438 4:811849-811871 CTGTCTTTGCTGACGTATGTTGG + Intronic
969348943 4:6586984-6587006 CTGTCTTTGCAGAAGGACACGGG + Exonic
970467889 4:16345969-16345991 CTGTCTTTGAAGATGGAAGAAGG - Intergenic
970622424 4:17837319-17837341 CCGTGTTTGCTTATGCAAGCAGG + Exonic
970645024 4:18109829-18109851 TTGATTTTGCAGATGGAAGCAGG - Intergenic
971391808 4:26193024-26193046 CTGGCTTTGAAGATGGAAGAAGG + Intronic
972387998 4:38586448-38586470 CTGACTTTGAGGATGGAAGGGGG - Intergenic
972434116 4:39015442-39015464 CTGGCTTTGAAGATGGAAGGAGG + Intronic
973143881 4:46801300-46801322 CTGTCTTTGCTATTGTAAGTAGG - Intronic
974152577 4:58028354-58028376 CTGTCCTTGTGTATGGAAGCTGG - Intergenic
974904583 4:68039003-68039025 CTGTCTCTGTTGCTGGAAGCTGG - Intergenic
975186973 4:71414751-71414773 CTTTCTTTCCTAATGGCAGCTGG + Intronic
976391719 4:84512398-84512420 CTGTGTGTACTGAAGGAAGCAGG + Intergenic
978268507 4:106858696-106858718 CTGTCCTTGCTGGTGGGAGTAGG - Intergenic
978306835 4:107338148-107338170 CTGACTTTGAGGATGGAAGATGG + Intergenic
978415061 4:108466216-108466238 CTGTGGTTGCTGAGGGAAGTAGG - Intergenic
981291598 4:143082728-143082750 CTGACTTTGAAGATGGAAGAAGG + Intergenic
982113316 4:152075778-152075800 CTGTCCCTGCTCAGGGAAGCAGG + Intergenic
982761471 4:159289457-159289479 CTATAATTGCTGATGGAAGGGGG + Intronic
983164029 4:164452363-164452385 ATGGAGTTGCTGATGGAAGCAGG - Intergenic
984449783 4:179884918-179884940 CTTTCTTTACACATGGAAGCAGG + Intergenic
984869061 4:184310955-184310977 GGGTCTTTGCTGGAGGAAGCTGG - Intergenic
985771908 5:1817169-1817191 TTGTCTTTGATGCTGGAGGCTGG + Intergenic
985902741 5:2809331-2809353 CTGTCTTTTCTGCAGGAACCTGG + Intergenic
986105765 5:4658061-4658083 CTGACTTTGCGGATGGAGGAAGG - Intergenic
986143708 5:5056579-5056601 GTGCCTCTGCTGATGGAGGCTGG + Intergenic
986227393 5:5828450-5828472 CAGGCCTTGCTGATGGCAGCAGG - Intergenic
986915562 5:12615493-12615515 CTGTCTTTTTTGATCCAAGCTGG - Intergenic
986987192 5:13513359-13513381 CTGGCTTTGAAAATGGAAGCAGG + Intergenic
987146459 5:14995542-14995564 CTTCCTTAGCTGATGCAAGCCGG + Intergenic
990373127 5:55141339-55141361 CTGTCTTTGCAGATGGATGAGGG - Intronic
990987273 5:61652329-61652351 CTGTCATTGCTGATAGAAGATGG + Intronic
991418001 5:66411369-66411391 CTGGCTTTGAAGATGGAAGGGGG + Intergenic
991923134 5:71677582-71677604 CTTTCCTTGTTGGTGGAAGCAGG + Intergenic
992090164 5:73309979-73310001 CTGTCTGTGCTGCTGGAAAAGGG + Intergenic
992368182 5:76114608-76114630 CTGTCTTTTCTGAGGGAATCAGG - Intronic
992390473 5:76326617-76326639 CCCTCTTTGCTGATGCCAGCTGG - Exonic
993229659 5:85217635-85217657 CTGTCTTTGCTTATGCCAGATGG - Intergenic
993514961 5:88820399-88820421 CTGTCTTTCATAATGGAAGTAGG - Intronic
994381735 5:99079560-99079582 CTGTCTATGCTGGAGGAAGTGGG + Intergenic
995331227 5:110949079-110949101 CTGTCTTTAGTCAAGGAAGCAGG + Intergenic
996016391 5:118538611-118538633 CTCACTTTGCAGATGGAAGACGG - Intergenic
996351825 5:122552211-122552233 CTGTCTTTGAAGATGGAGGAAGG + Intergenic
999407357 5:151318115-151318137 CTTCTTTTGCTGATGTAAGCGGG - Intronic
999578273 5:153005310-153005332 CTGTGTTTGTTGATGGCAGCTGG - Intergenic
999914612 5:156243666-156243688 CTGTCTTTGCTGAAAGAACTAGG + Intronic
1000415641 5:160980902-160980924 CTGCCTTTGCTGATGGCTGTGGG + Intergenic
1001080344 5:168663046-168663068 CTGTCTTGGTTGATGGGGGCTGG + Intronic
1001670490 5:173469452-173469474 CTGTCTCTGTGGATGGAAGAGGG - Intergenic
1002805816 6:573006-573028 CTGCCTTTGCTGTTAGAAGGCGG - Intronic
1003441864 6:6150285-6150307 CTGTCGTTTCTGACGAAAGCAGG + Intronic
1003897317 6:10619907-10619929 CTGCCTTTGCTGTTTGAAGATGG - Intronic
1004888302 6:20072719-20072741 CTGGCTTTGAAGATGGAAGAGGG - Intergenic
1004905622 6:20234715-20234737 CTGGCTTTGAAGATGGAAGGGGG - Intergenic
1004998359 6:21216028-21216050 CTGACTTCGAAGATGGAAGCAGG + Intronic
1005055728 6:21727185-21727207 CTATATTTGCTGATGGAGGAGGG - Intergenic
1005103671 6:22200397-22200419 TTGGCTTTCCTGATGGCAGCAGG + Intergenic
1005618837 6:27601629-27601651 CTTTCTTTGGTGATGGGAGAAGG - Intergenic
1005728060 6:28669105-28669127 CTGTCTTTGAAGATGGAGGAAGG + Intergenic
1007330139 6:41100767-41100789 CTGTCTTTTCTACTGGAAACGGG - Intergenic
1007478014 6:42132030-42132052 CTGGCTTTGAAGATGGAAGGAGG + Intronic
1007833275 6:44655147-44655169 CTGTCTTTGCTAAGGAAAGAAGG + Intergenic
1009803700 6:68574804-68574826 CTGTGTTTGCTGAAATAAGCCGG + Intergenic
1012764744 6:103352637-103352659 CTGTCATTCCTGGTGGAAGGTGG + Intergenic
1014426587 6:121314174-121314196 CTGTTTTTGAAGATGGAAGTAGG - Intronic
1015723673 6:136275678-136275700 CTGTCTTTAGTCAAGGAAGCAGG + Exonic
1018793167 6:167165531-167165553 CTGTCTTTGCTGATGGAAGCTGG - Intronic
1019405794 7:883352-883374 CTCTCTTGGCAGACGGAAGCTGG - Intronic
1019588095 7:1815516-1815538 TTCCCTTTGCTGATGGAACCCGG - Intergenic
1020623537 7:10548320-10548342 CAGTTTTTGCTGTTGGAAGGGGG - Intergenic
1022358988 7:29641604-29641626 CTGTATGTTCTGGTGGAAGCAGG + Intergenic
1023108051 7:36782482-36782504 CTGTCTTTGCGGATCAAAGATGG + Intergenic
1024134241 7:46390348-46390370 CTGGGTTTGCTCTTGGAAGCTGG - Intergenic
1024342579 7:48282430-48282452 CTGTCTTAGCTGATGGCAGTGGG + Intronic
1025768626 7:64482667-64482689 CAGTCTTTGCTGATGGCTGTGGG + Intergenic
1027607881 7:80322924-80322946 ATGTCTTTGGTGATGGCATCAGG - Intergenic
1028123637 7:87086087-87086109 CTGGCTTTGAAGATGGAAGATGG + Intergenic
1028205800 7:88015390-88015412 CTGTCTCTGCTCATGTAACCAGG + Intronic
1028583934 7:92434696-92434718 TTGTCTTTGAAGATGGAAGAAGG + Intergenic
1028953585 7:96664430-96664452 CTGTCTTTGAAGATGGAGGAGGG - Intronic
1029046538 7:97635249-97635271 CTGACTTTGCTGAAGAAATCTGG + Intergenic
1030596171 7:111541427-111541449 TTATCTTTGCTGCTGAAAGCAGG - Intronic
1031373313 7:120994666-120994688 TTGTTGTTACTGATGGAAGCAGG + Intronic
1031983408 7:128145426-128145448 ATGTCTATCCTGCTGGAAGCAGG - Intergenic
1033132062 7:138753146-138753168 GGGTCTTTGCAGATGGAATCAGG + Intronic
1033222026 7:139533718-139533740 CTATCTTTGGTGAAGGAAACAGG + Intronic
1033411069 7:141118272-141118294 CTGCCTTTGCTCTTGGAATCAGG + Intronic
1034281882 7:149860313-149860335 GTGTCTTAGCTGATAGAAGATGG + Intronic
1034937581 7:155209907-155209929 CTGTGTTTGCTCATAGGAGCAGG - Intergenic
1035478340 7:159159502-159159524 CTGTCTTTCCAGATGGAACTGGG - Intergenic
1035593141 8:833480-833502 CTGGCTTTGCAGATGGAGGTGGG - Intergenic
1035720868 8:1790776-1790798 CTGTCTCTGCTGTTGTGAGCCGG - Intergenic
1036777486 8:11623620-11623642 ATGTCTGTGATGATGGAGGCAGG - Intergenic
1037216026 8:16452133-16452155 CTGTCTTTCTTGCTGGAACCTGG + Intronic
1037843341 8:22261311-22261333 CTGAGATTGCTGAGGGAAGCAGG - Intergenic
1039015901 8:33148305-33148327 TTGACTTTGTTGATGGAAGCTGG - Intergenic
1039273278 8:35906676-35906698 CTGTCTTTGCAGATGGACAGAGG - Intergenic
1039809718 8:41035687-41035709 CTGACTTTGCTGATGCCAGAGGG - Intergenic
1039997925 8:42550530-42550552 CTGGCTTTGCAGATGGAGGAAGG - Intronic
1040386265 8:46916810-46916832 CTGGATTTCCTGATGGGAGCTGG + Intergenic
1041202879 8:55468082-55468104 CTGTCTTCTGTGATGGAAACTGG - Intronic
1041458313 8:58084109-58084131 CTGTCTTTCCTGAGGTCAGCAGG + Intronic
1042459578 8:69047672-69047694 CTGACTCTGCTGAGAGAAGCAGG - Intergenic
1043495212 8:80792672-80792694 CTGGCTTTGCTGAAGCAAGCTGG + Intronic
1044528867 8:93285040-93285062 ACTTCTTTGCTGAAGGAAGCTGG - Intergenic
1045000319 8:97872646-97872668 CTGGCTTTGAGGATGGAAGAAGG - Intronic
1045425159 8:102058911-102058933 CTGTCTTTGAAGATGGAGGAGGG + Intronic
1046704258 8:117433392-117433414 CTGGCTTTGCAGATGGAGGAAGG - Intergenic
1046775305 8:118158294-118158316 CTGTTCTTGCTGGTGTAAGCAGG - Intergenic
1047215652 8:122873850-122873872 CTGGCTTTGAAGATGGAAGGGGG - Intronic
1048247965 8:132830190-132830212 CTGACTTTGAAGATGGGAGCAGG - Intronic
1048445728 8:134491631-134491653 TTGGCTTTGAAGATGGAAGCAGG - Intronic
1050420034 9:5453808-5453830 ATGTCTTTGCTGTGGGAGGCTGG + Intronic
1054990187 9:71316588-71316610 CTGTCTTTGAAGATGGAAGGAGG + Intronic
1056118143 9:83461247-83461269 CTGGCTTTGAAGATGGAGGCAGG + Intronic
1056713902 9:89012909-89012931 CTGTGCTTGCTGGTGGGAGCGGG - Intergenic
1057211623 9:93203814-93203836 CTGTGTGTGGTGATTGAAGCCGG + Intronic
1057948605 9:99351901-99351923 CTGTTCTCCCTGATGGAAGCAGG + Intergenic
1059152613 9:111963153-111963175 CTGACTTTGAAGATGGAAGAAGG + Intergenic
1059238230 9:112780483-112780505 GTGGGTTTGCTGATGGCAGCTGG + Intronic
1059349622 9:113655278-113655300 CTGTCTGCGCTGAAGGCAGCAGG - Intergenic
1060713864 9:125901170-125901192 CTGGCATTACTGACGGAAGCGGG - Intronic
1061149371 9:128820263-128820285 CTGTCTTCCCAGAAGGAAGCTGG - Exonic
1061415974 9:130447002-130447024 TTGTCTTTGGTGATGGACGAAGG - Intronic
1062395014 9:136349345-136349367 CTGTCATTGCTGGTATAAGCCGG + Intronic
1185660585 X:1725705-1725727 CTGGCTTTGCTGATGGAGGAAGG + Intergenic
1186068826 X:5795516-5795538 CTGTTTTTGCTGATGGTATACGG + Intergenic
1186383122 X:9081874-9081896 ATGTCTTTGCTGCTGAAGGCAGG + Intronic
1186489345 X:9959436-9959458 CTGGCTTTGCGGATGGAGGAAGG - Intergenic
1188557015 X:31423956-31423978 CCGTCTTCTCTGATTGAAGCAGG - Intronic
1189097672 X:38157435-38157457 CTGTCTTTGAAGATGGAGGAAGG - Intronic
1189616045 X:42785420-42785442 ATGTCTTTGCTGATGACATCAGG - Intergenic
1189992642 X:46609269-46609291 CACTCTTTGCAGAGGGAAGCAGG + Intronic
1192542656 X:71988353-71988375 CTGCCTTTGCTGATGGCTGTAGG - Intergenic
1193318982 X:80098024-80098046 CTGTCTTTCATCATGGAAGAAGG - Intergenic
1193866472 X:86737982-86738004 CTGGCTTTGAAGATGGAAGAAGG - Intronic
1194778013 X:97989850-97989872 CTGTAGTTGCTGCTGGCAGCTGG - Intergenic
1195583584 X:106535994-106536016 CTGGCTTTGATGATGGAAGAAGG + Intergenic
1196560083 X:117135754-117135776 CTGGCTTTGAAGATGGAAGATGG + Intergenic
1198431219 X:136568049-136568071 CTGGCTTTGAAGATGGAGGCCGG - Intergenic
1198953274 X:142097587-142097609 CTGGCTTTGAAGATGGAAGAAGG - Intergenic
1199318908 X:146415099-146415121 CTGTCTTTGAAGATAGAAGAAGG + Intergenic
1199680771 X:150223075-150223097 CTGTATTTGCTGTTGAAGGCAGG - Intergenic
1199763815 X:150926035-150926057 CTGGCTTTGCAGATGGAGGAAGG + Intergenic
1199891317 X:152085535-152085557 TTTTCTTTGCGGATGGAAGAAGG + Intergenic
1201932422 Y:19365840-19365862 ATGTTTCTGCTGATGTAAGCAGG - Intergenic
1202377955 Y:24255392-24255414 CGCTCTGTGCTGATGGAGGCTGG - Intergenic
1202492827 Y:25414729-25414751 CGCTCTGTGCTGATGGAGGCTGG + Intergenic