ID: 1018793524

View in Genome Browser
Species Human (GRCh38)
Location 6:167168813-167168835
Sequence CTCAGTCATCTCTACAAGTT GGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 132
Summary {0: 2, 1: 0, 2: 0, 3: 8, 4: 122}

Found 3 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1018793524_1018793526 -1 Left 1018793524 6:167168813-167168835 CCCAACTTGTAGAGATGACTGAG 0: 2
1: 0
2: 0
3: 8
4: 122
Right 1018793526 6:167168835-167168857 GAAAAGCTTCCAGAAACTCGAGG No data
1018793524_1018793528 19 Left 1018793524 6:167168813-167168835 CCCAACTTGTAGAGATGACTGAG 0: 2
1: 0
2: 0
3: 8
4: 122
Right 1018793528 6:167168855-167168877 AGGACATCACAACTTCCAGCTGG 0: 2
1: 0
2: 0
3: 6
4: 94
1018793524_1018793529 20 Left 1018793524 6:167168813-167168835 CCCAACTTGTAGAGATGACTGAG 0: 2
1: 0
2: 0
3: 8
4: 122
Right 1018793529 6:167168856-167168878 GGACATCACAACTTCCAGCTGGG 0: 2
1: 0
2: 1
3: 5
4: 88

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1018793524 Original CRISPR CTCAGTCATCTCTACAAGTT GGG (reversed) Intronic