ID: 1018794805

View in Genome Browser
Species Human (GRCh38)
Location 6:167177477-167177499
Sequence CTGCGAGCCCCCAGACGCAC GGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 115
Summary {0: 2, 1: 0, 2: 3, 3: 9, 4: 101}

Found 1 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1018794805_1018794810 7 Left 1018794805 6:167177477-167177499 CCCGTGCGTCTGGGGGCTCGCAG 0: 2
1: 0
2: 3
3: 9
4: 101
Right 1018794810 6:167177507-167177529 CGATCCCTGCTTCTGCACTGCGG 0: 2
1: 0
2: 1
3: 15
4: 142

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1018794805 Original CRISPR CTGCGAGCCCCCAGACGCAC GGG (reversed) Intronic
900187977 1:1341887-1341909 CTGCCAGCTCCCAGACCCACAGG - Intronic
900962797 1:5936323-5936345 CTGCCAGCCCACAGAGGGACCGG + Intronic
901154395 1:7125677-7125699 CCGCCAGCCCCCAGTCGCCCCGG - Intronic
901781764 1:11598974-11598996 CTGGGAGTCCCCAGAAGCCCAGG - Intergenic
901934549 1:12618486-12618508 CTGCGAGCCCTCAGGGACACCGG - Intergenic
902600836 1:17539537-17539559 CTGCGAGCCCCCAGCGGTCCCGG - Intergenic
903798181 1:25946102-25946124 CTGCCAGCCCCCAGACTCACTGG - Intergenic
904602909 1:31683597-31683619 CTGCCTGCCCCCAGAGGCACAGG - Intronic
904611247 1:31727446-31727468 CTGGGAGCCCACAGAACCACCGG - Exonic
905145487 1:35883974-35883996 CTCCGACTCCCCAGACCCACGGG - Intronic
907326100 1:53639427-53639449 CTGCCAGCCCCGAGAGGGACAGG - Intronic
909238435 1:73181367-73181389 CTGCGACACCCCAAAGGCACGGG + Intergenic
912246358 1:107965217-107965239 CCGCAAGTCCCCAGACGCGCGGG + Intergenic
922784602 1:228276714-228276736 CTGCCGGCCCCCCAACGCACCGG - Exonic
924442867 1:244101156-244101178 CAGCGAGGCCCCAGAGGCACAGG - Intergenic
1068460513 10:57322406-57322428 CAGCGAGACCACAAACGCACCGG + Intergenic
1071347527 10:84706966-84706988 CTGCCAGCACACAGAAGCACAGG - Intergenic
1073542711 10:104326218-104326240 CTGCCAGCCAGCAGAGGCACAGG + Intronic
1076066344 10:127451177-127451199 CTGCCAGCCCCAAGTCGGACAGG + Intronic
1077105947 11:842714-842736 CCGGGAGCCCCGGGACGCACAGG - Intergenic
1077119345 11:899653-899675 CAGGGAGCCCCCAGACCCCCGGG - Intronic
1077162985 11:1122017-1122039 CTGGGAGCCCCCACCCGCCCAGG + Intergenic
1080074599 11:28134383-28134405 CTAAGAGCCCACATACGCACGGG - Intronic
1080451882 11:32384674-32384696 TTGCGAGCCCCAAGCCTCACTGG - Intergenic
1085739212 11:79064827-79064849 CTCCGGCCCCACAGACGCACGGG + Exonic
1086085206 11:82946145-82946167 CTCCCAGCCCCCAAAAGCACAGG + Intronic
1103212409 12:119176446-119176468 CTGCAAGCCGCATGACGCACCGG - Intergenic
1104481989 12:129115666-129115688 CTGGGATCCCCCAGGCACACTGG + Intronic
1104521769 12:129482128-129482150 CAGCCAGCCCCCAGACACACGGG + Intronic
1105801042 13:23903578-23903600 CTGAGAGCCCCCAGCCGCGCTGG - Intergenic
1108855404 13:54787135-54787157 CAGCGAGACCCCAAACCCACCGG - Intergenic
1113866870 13:113532293-113532315 CCGTGAGCCCCCAGACGCACAGG + Intronic
1114031612 14:18584527-18584549 CTGCCAGCCCCACGACCCACAGG - Intergenic
1116221788 14:42096578-42096600 CTCCCAGCCCCCAGGAGCACAGG + Intergenic
1118326644 14:64785912-64785934 CTTGGAGCCCCCAGACTCCCTGG - Exonic
1119702046 14:76762017-76762039 CTGCGAGCCCCGAGGCCCAGCGG - Intergenic
1125430409 15:39588138-39588160 CTCCCAGCCCCCAGATGAACGGG + Exonic
1128649120 15:69397624-69397646 CTGTGACCCCCCAGAAGCTCAGG - Intronic
1129377839 15:75145378-75145400 CTCCCAGCCCCCAAAAGCACAGG + Intergenic
1129847376 15:78774112-78774134 CTGCCTGCCCCCAGCCCCACTGG - Intronic
1130192674 15:81751323-81751345 TTGCAAGCCCCCAAACTCACTGG - Intergenic
1130254527 15:82319800-82319822 CTGCCTGCCCCCAGCCCCACTGG + Intergenic
1130600438 15:85270170-85270192 CTGCCTGCCCCCAGCCCCACTGG - Intergenic
1132499862 16:280517-280539 CAGAGAGCCCCCAGCCGCTCCGG - Intronic
1134462114 16:14438465-14438487 CAGTGAGCCACCAGACACACAGG + Intronic
1136399470 16:30009941-30009963 CTCCAAGCCCCCAGACTCACTGG + Exonic
1144107243 17:11997285-11997307 CCGCGCGCTCCCAGACGCATGGG + Exonic
1153692430 18:7606964-7606986 CTGGGAGCCCCCAGATGAGCTGG - Intronic
1154347038 18:13551004-13551026 CTGCTATCCCCCAGAGGCAGAGG - Intronic
1156616997 18:38799177-38799199 CAGAGAGCCCCCCGACCCACAGG + Intergenic
1157260904 18:46174615-46174637 CTCCAAGCCCCCAGACGCTGGGG + Intronic
1161104651 19:2437246-2437268 CTCCGAGCCCCCGGAGGCAGAGG + Intronic
1166343568 19:42152168-42152190 CTGTGAGCCCCCATGCCCACAGG + Intronic
1166688360 19:44809124-44809146 CATGGAGCCCCCGGACGCACCGG + Exonic
926309878 2:11667812-11667834 ATTGGAGCCCCCAGACCCACGGG + Intronic
928168844 2:28990492-28990514 TTGCCAGACCCCAGACTCACAGG + Intronic
933581122 2:84128211-84128233 CAGCGAGACCACAGACCCACTGG + Intergenic
935405816 2:102707923-102707945 CTGGGAGCACCCATACCCACAGG - Intronic
941773251 2:169364577-169364599 CTGCGCGCCCACGGGCGCACTGG - Intergenic
944842981 2:203642114-203642136 CAGCGAGGCCACAGACCCACCGG - Intergenic
948112621 2:235468993-235469015 CTGACAGCCCCTAGACTCACAGG - Intergenic
1178438261 21:32578339-32578361 CTGCGAGCCCTCAGACTCACGGG + Intronic
1180455724 22:15511584-15511606 CTGCCAGCCCCACGACCCACAGG - Intergenic
1181038378 22:20180506-20180528 CTGCGGTCACCCAGACACACTGG - Intergenic
1181434072 22:22900208-22900230 CTGGCAGCCCCCAGACGCCCAGG - Intergenic
1181435010 22:22905574-22905596 CTGGCAGCCCCCAGACGCCCAGG - Intergenic
1183467237 22:37985886-37985908 CTCCGAGGCCCCAGACACACTGG - Intronic
1183471197 22:38007603-38007625 CTGCCAGCCACCAGAAGCCCTGG - Intronic
1185312113 22:50161948-50161970 CTGCAAACTCCCAGAAGCACTGG - Intergenic
1185368565 22:50447996-50448018 CTGCCAGACTCCAGACTCACGGG + Intronic
950637177 3:14323492-14323514 CTGCCAGCCCTCAGATGGACAGG - Intergenic
952181503 3:30921056-30921078 CTGCCAGCACCCAAAAGCACTGG + Intergenic
959555049 3:107707227-107707249 CTGAGAACCACCAGATGCACAGG - Intronic
961318186 3:126054903-126054925 TTGCAAGCCCACAGAAGCACAGG + Intronic
961635214 3:128328954-128328976 CTGCGAGCCTCCTGAGACACAGG - Intronic
967878581 3:194283002-194283024 CTCTGAGCTCCCAGCCGCACAGG + Intergenic
968232297 3:197011129-197011151 CTGCCAGCCCCCAGACAGCCGGG + Intronic
968479657 4:827481-827503 CTGTGAACCCCCAGGCCCACGGG - Intergenic
968742825 4:2339972-2339994 CAGGGAGCCCCCAGACCCAAGGG - Intronic
968957593 4:3727127-3727149 CTGCTTGCCCCCATACTCACAGG + Intergenic
968981967 4:3855126-3855148 ATGCAAGCCTGCAGACGCACGGG - Intergenic
969285751 4:6200794-6200816 CTGAGCGCCCCCAGCCGCGCCGG + Intergenic
979865263 4:125745286-125745308 CTGGGAGACTCCAGCCGCACAGG - Intergenic
983843040 4:172481262-172481284 CTGCGAGACCACAAACCCACCGG - Intronic
985521289 5:374958-374980 CCGGCAGCCCCCAGACCCACAGG - Intronic
993727104 5:91380895-91380917 CTGGGCGCCCCCAGAAGCCCGGG + Intronic
997257137 5:132437805-132437827 CTGCCCGCCCCCATACACACTGG - Intronic
1004306947 6:14509673-14509695 CTGCCAGCCCCTCGACCCACTGG + Intergenic
1006832887 6:36979418-36979440 CTGCTAGCTTCCAGATGCACAGG - Intronic
1011449007 6:87473122-87473144 CAGCCAGGCCCCAGAGGCACTGG - Intronic
1012006107 6:93715562-93715584 CTGAGAACCCCCAGAAGCTCAGG + Intergenic
1014460120 6:121685833-121685855 CAGCAAGCCCACAGACCCACCGG - Intergenic
1017964946 6:159256062-159256084 CTGAGAGACCCCACACGCCCAGG - Intronic
1018420435 6:163636117-163636139 CTGCGAGCCCCGCGATGCATCGG + Intergenic
1018794805 6:167177477-167177499 CTGCGAGCCCCCAGACGCACGGG - Intronic
1018821513 6:167377590-167377612 CTGCGAGCCCCCAGACGCACGGG + Intronic
1018901443 6:168053804-168053826 CTGTGAGATCCCAGACACACAGG + Intergenic
1023127981 7:36974037-36974059 CAGGGAGGCTCCAGACGCACAGG - Intronic
1023515352 7:40996283-40996305 CTCTGAGCCTCCAGATGCACAGG - Intergenic
1029896618 7:103990111-103990133 CTGCGAGCCCCGAGGGGCGCGGG - Intergenic
1035240984 7:157529073-157529095 CTGGGAGGCCACAGACGCAGAGG - Intergenic
1039414601 8:37383100-37383122 CTGCCAGCACCCAGAGGCATGGG + Intergenic
1039948815 8:42152479-42152501 CTGGAAGCCCCCAGCCCCACTGG - Intergenic
1040559895 8:48514734-48514756 CTGCCAGCCCCCGGACGCCAGGG - Intergenic
1048177575 8:132166572-132166594 CTGAGAGCCCCCAGAAGTTCAGG - Intronic
1049392983 8:142381564-142381586 CTGGGAGACCCCAGAAGCAGAGG + Intronic
1051121657 9:13758886-13758908 CTGTGAGCCCCCATCCCCACAGG + Intergenic
1051248772 9:15138141-15138163 CTGCTAGCCCCCAAATGCTCAGG - Intergenic
1057832720 9:98419283-98419305 CTGGGATCCCCCAGTCACACTGG + Intronic
1061957222 9:133969998-133970020 CTGCCACCCCCCAGACGTGCAGG + Intronic
1061970990 9:134045385-134045407 CCGAGAGTACCCAGACGCACAGG - Exonic
1062126397 9:134865226-134865248 CTGAGTGCCCCCAGAAGCCCAGG - Intergenic
1062599294 9:137312742-137312764 CTCAGAGCCCCCAGACACCCTGG - Intronic
1189967114 X:46386368-46386390 CTGCTAGCTCTCAGACACACTGG - Intergenic
1195939415 X:110155598-110155620 CTGAGAGCCCACAGTCGGACAGG - Intronic