ID: 1018798352

View in Genome Browser
Species Human (GRCh38)
Location 6:167204139-167204161
Sequence GGCCGTCCACGCCTGGGCTT GGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total
Summary

Found 3 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1018798352_1018798358 -8 Left 1018798352 6:167204139-167204161 CCCAAGCCCAGGCGTGGACGGCC No data
Right 1018798358 6:167204154-167204176 GGACGGCCCTCATCTCAGGAGGG No data
1018798352_1018798361 5 Left 1018798352 6:167204139-167204161 CCCAAGCCCAGGCGTGGACGGCC No data
Right 1018798361 6:167204167-167204189 CTCAGGAGGGTGCACACTCCTGG No data
1018798352_1018798357 -9 Left 1018798352 6:167204139-167204161 CCCAAGCCCAGGCGTGGACGGCC No data
Right 1018798357 6:167204153-167204175 TGGACGGCCCTCATCTCAGGAGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1018798352 Original CRISPR GGCCGTCCACGCCTGGGCTT GGG (reversed) Intergenic