ID: 1018799552

View in Genome Browser
Species Human (GRCh38)
Location 6:167211287-167211309
Sequence GGATGGGAATAGAACATCCC TGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 1 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1018799552_1018799557 25 Left 1018799552 6:167211287-167211309 CCAGGGATGTTCTATTCCCATCC No data
Right 1018799557 6:167211335-167211357 AAAAAAAAAAAAAAAAAAAAAGG 0: 22235
1: 21563
2: 42018
3: 80771
4: 155626

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1018799552 Original CRISPR GGATGGGAATAGAACATCCC TGG (reversed) Intergenic
No off target data available for this crispr