ID: 1018799557

View in Genome Browser
Species Human (GRCh38)
Location 6:167211335-167211357
Sequence AAAAAAAAAAAAAAAAAAAA AGG
Strand +
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total 322213
Summary {0: 22235, 1: 21563, 2: 42018, 3: 80771, 4: 155626}

Found 6 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1018799552_1018799557 25 Left 1018799552 6:167211287-167211309 CCAGGGATGTTCTATTCCCATCC No data
Right 1018799557 6:167211335-167211357 AAAAAAAAAAAAAAAAAAAAAGG 0: 22235
1: 21563
2: 42018
3: 80771
4: 155626
1018799555_1018799557 8 Left 1018799555 6:167211304-167211326 CCATCCAGAGAGGTGCTTTTTTT No data
Right 1018799557 6:167211335-167211357 AAAAAAAAAAAAAAAAAAAAAGG 0: 22235
1: 21563
2: 42018
3: 80771
4: 155626
1018799550_1018799557 27 Left 1018799550 6:167211285-167211307 CCCCAGGGATGTTCTATTCCCAT No data
Right 1018799557 6:167211335-167211357 AAAAAAAAAAAAAAAAAAAAAGG 0: 22235
1: 21563
2: 42018
3: 80771
4: 155626
1018799551_1018799557 26 Left 1018799551 6:167211286-167211308 CCCAGGGATGTTCTATTCCCATC No data
Right 1018799557 6:167211335-167211357 AAAAAAAAAAAAAAAAAAAAAGG 0: 22235
1: 21563
2: 42018
3: 80771
4: 155626
1018799554_1018799557 9 Left 1018799554 6:167211303-167211325 CCCATCCAGAGAGGTGCTTTTTT No data
Right 1018799557 6:167211335-167211357 AAAAAAAAAAAAAAAAAAAAAGG 0: 22235
1: 21563
2: 42018
3: 80771
4: 155626
1018799556_1018799557 4 Left 1018799556 6:167211308-167211330 CCAGAGAGGTGCTTTTTTTTTTT No data
Right 1018799557 6:167211335-167211357 AAAAAAAAAAAAAAAAAAAAAGG 0: 22235
1: 21563
2: 42018
3: 80771
4: 155626

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1018799557 Original CRISPR AAAAAAAAAAAAAAAAAAAA AGG Intergenic
Too many off-targets to display for this crispr