ID: 1018800375

View in Genome Browser
Species Human (GRCh38)
Location 6:167217671-167217693
Sequence CTGGTGAGTTGAAGCAACCA AGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 7 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1018800375_1018800386 13 Left 1018800375 6:167217671-167217693 CCTTGGTTGCTTCAACTCACCAG No data
Right 1018800386 6:167217707-167217729 GACTCGCTCTCTGGCTCTGGGGG 0: 2
1: 0
2: 0
3: 17
4: 310
1018800375_1018800384 11 Left 1018800375 6:167217671-167217693 CCTTGGTTGCTTCAACTCACCAG No data
Right 1018800384 6:167217705-167217727 AGGACTCGCTCTCTGGCTCTGGG 0: 2
1: 0
2: 0
3: 18
4: 245
1018800375_1018800383 10 Left 1018800375 6:167217671-167217693 CCTTGGTTGCTTCAACTCACCAG No data
Right 1018800383 6:167217704-167217726 TAGGACTCGCTCTCTGGCTCTGG 0: 2
1: 0
2: 1
3: 12
4: 205
1018800375_1018800376 -9 Left 1018800375 6:167217671-167217693 CCTTGGTTGCTTCAACTCACCAG No data
Right 1018800376 6:167217685-167217707 ACTCACCAGCCCCATCCTCTAGG 0: 2
1: 0
2: 3
3: 21
4: 284
1018800375_1018800385 12 Left 1018800375 6:167217671-167217693 CCTTGGTTGCTTCAACTCACCAG No data
Right 1018800385 6:167217706-167217728 GGACTCGCTCTCTGGCTCTGGGG 0: 2
1: 0
2: 1
3: 20
4: 201
1018800375_1018800387 26 Left 1018800375 6:167217671-167217693 CCTTGGTTGCTTCAACTCACCAG No data
Right 1018800387 6:167217720-167217742 GCTCTGGGGGCTGTTTCCAGAGG 0: 2
1: 0
2: 2
3: 28
4: 298
1018800375_1018800381 4 Left 1018800375 6:167217671-167217693 CCTTGGTTGCTTCAACTCACCAG No data
Right 1018800381 6:167217698-167217720 ATCCTCTAGGACTCGCTCTCTGG 0: 2
1: 0
2: 0
3: 10
4: 50

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1018800375 Original CRISPR CTGGTGAGTTGAAGCAACCA AGG (reversed) Intergenic
No off target data available for this crispr