ID: 1018800917

View in Genome Browser
Species Human (GRCh38)
Location 6:167221740-167221762
Sequence CCCGGCTCACGTCACCCCCG TGG
Strand +
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 5 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1018800910_1018800917 2 Left 1018800910 6:167221715-167221737 CCGGCTTGCCACCAGTCATTTAG No data
Right 1018800917 6:167221740-167221762 CCCGGCTCACGTCACCCCCGTGG No data
1018800913_1018800917 -6 Left 1018800913 6:167221723-167221745 CCACCAGTCATTTAGGCCCCGGC No data
Right 1018800917 6:167221740-167221762 CCCGGCTCACGTCACCCCCGTGG No data
1018800908_1018800917 14 Left 1018800908 6:167221703-167221725 CCAGTGTGAGTCCCGGCTTGCCA No data
Right 1018800917 6:167221740-167221762 CCCGGCTCACGTCACCCCCGTGG No data
1018800909_1018800917 3 Left 1018800909 6:167221714-167221736 CCCGGCTTGCCACCAGTCATTTA No data
Right 1018800917 6:167221740-167221762 CCCGGCTCACGTCACCCCCGTGG No data
1018800914_1018800917 -9 Left 1018800914 6:167221726-167221748 CCAGTCATTTAGGCCCCGGCTCA No data
Right 1018800917 6:167221740-167221762 CCCGGCTCACGTCACCCCCGTGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1018800917 Original CRISPR CCCGGCTCACGTCACCCCCG TGG Intergenic
No off target data available for this crispr