ID: 1018801911

View in Genome Browser
Species Human (GRCh38)
Location 6:167229470-167229492
Sequence TGGTACTCCTTGAAAAAAAC AGG
Strand +
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 1 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1018801909_1018801911 -8 Left 1018801909 6:167229455-167229477 CCTCTTCTGGTAGCCTGGTACTC No data
Right 1018801911 6:167229470-167229492 TGGTACTCCTTGAAAAAAACAGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1018801911 Original CRISPR TGGTACTCCTTGAAAAAAAC AGG Intergenic
No off target data available for this crispr