ID: 1018811727

View in Genome Browser
Species Human (GRCh38)
Location 6:167303095-167303117
Sequence TGGAATGAACCCCTTTGGGT GGG
Strand +
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 3 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1018811715_1018811727 9 Left 1018811715 6:167303063-167303085 CCACCCGTGGTTTCAGGCATCCG 0: 1
1: 0
2: 2
3: 27
4: 126
Right 1018811727 6:167303095-167303117 TGGAATGAACCCCTTTGGGTGGG No data
1018811716_1018811727 6 Left 1018811716 6:167303066-167303088 CCCGTGGTTTCAGGCATCCGCTG 0: 1
1: 5
2: 22
3: 59
4: 160
Right 1018811727 6:167303095-167303117 TGGAATGAACCCCTTTGGGTGGG No data
1018811717_1018811727 5 Left 1018811717 6:167303067-167303089 CCGTGGTTTCAGGCATCCGCTGG 0: 3
1: 93
2: 212
3: 341
4: 506
Right 1018811727 6:167303095-167303117 TGGAATGAACCCCTTTGGGTGGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1018811727 Original CRISPR TGGAATGAACCCCTTTGGGT GGG Intronic
No off target data available for this crispr