ID: 1018812443

View in Genome Browser
Species Human (GRCh38)
Location 6:167307773-167307795
Sequence CACGTGGGTCACCGCGCCTG GGG (reversed)
Strand -
Crispr in exon? Yes
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total 64
Summary {0: 1, 1: 0, 2: 0, 3: 11, 4: 52}

Found 2 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1018812443_1018812449 4 Left 1018812443 6:167307773-167307795 CCCCAGGCGCGGTGACCCACGTG 0: 1
1: 0
2: 0
3: 11
4: 52
Right 1018812449 6:167307800-167307822 GCATGATTGCCCTACTGCTGTGG 0: 1
1: 0
2: 0
3: 6
4: 107
1018812443_1018812452 26 Left 1018812443 6:167307773-167307795 CCCCAGGCGCGGTGACCCACGTG 0: 1
1: 0
2: 0
3: 11
4: 52
Right 1018812452 6:167307822-167307844 GAGACCTCGTGCTGACCATCTGG 0: 1
1: 0
2: 0
3: 4
4: 48

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1018812443 Original CRISPR CACGTGGGTCACCGCGCCTG GGG (reversed) Exonic
900651869 1:3733752-3733774 CACATGCTTCCCCGCGCCTGGGG - Exonic
901956987 1:12793509-12793531 CTCCTGGGTCACCTCACCTGGGG - Exonic
901964992 1:12859291-12859313 CTCCTGGGTCACCTCACCTGGGG - Exonic
901969422 1:12895544-12895566 CACCTGAGTCACCTCACCTGGGG + Exonic
901972318 1:12917974-12917996 CACCTGGGTCACCTCACCTGGGG - Exonic
901980383 1:13029645-13029667 CTCCTGGGTCACCTCACCTGGGG - Intronic
902001704 1:13199286-13199308 CTCCTGGGTCACCTCACCTGGGG + Intergenic
902005107 1:13225803-13225825 CACCTGGGTCACCTCACCTGGGG + Intergenic
902007802 1:13246144-13246166 CACCTGAGTCACCTCACCTGAGG - Intergenic
902012861 1:13283788-13283810 CACCTGGGTCACCTCACCTGGGG + Exonic
902015750 1:13306236-13306258 CACCTGAGTCACCTCACCTGGGG - Intronic
902020932 1:13345011-13345033 CTCCTGGGTCACCTCACCTGGGG + Exonic
902024332 1:13371597-13371619 CACCTGGGTCACCTCACCTGGGG + Exonic
902026778 1:13389939-13389961 CACCTGAGTCACCTCACCTGGGG - Exonic
908272664 1:62436437-62436459 AAGGAGGGGCACCGCGCCTGAGG + Intronic
917743355 1:177983352-177983374 GAGGTGGGTCACTGCCCCTGAGG - Intronic
919809054 1:201397892-201397914 CATGTGGGTCAGTGTGCCTGGGG - Intronic
1071708582 10:88026354-88026376 CACGTGGGGAACCCCGCCTGAGG - Intergenic
1071875231 10:89837329-89837351 CACCCAGGTCACCACGCCTGGGG - Intergenic
1076428888 10:130387974-130387996 GGCGTGAGCCACCGCGCCTGGGG + Intergenic
1077522834 11:3046425-3046447 CACTTGGGTGACCGCGCTGGAGG + Intronic
1081597827 11:44471441-44471463 CATCTGGGTGACAGCGCCTGTGG + Intergenic
1082010882 11:47448968-47448990 CACGTGGGACACAGGGCTTGGGG - Exonic
1085022516 11:73218335-73218357 CACGTGGGTCTCTGCGGCTGCGG + Exonic
1092463392 12:8706370-8706392 CAGGTGGATCACCTCACCTGAGG - Intronic
1097294372 12:57946733-57946755 GGCGTGAGCCACCGCGCCTGGGG + Intronic
1104286213 12:127427087-127427109 CATGTGGGTCATTGCCCCTGCGG - Intergenic
1119424045 14:74524467-74524489 CACGTGTGTGCCCGCTCCTGGGG - Intronic
1122264733 14:100541312-100541334 CAGGTGGGTCACTGGGCCTCCGG - Intronic
1125834502 15:42737319-42737341 AATGTGGATCACAGCGCCTGGGG + Intergenic
1128502341 15:68235351-68235373 CTCGTGGCTCACCGTGGCTGTGG - Intronic
1131152499 15:90055833-90055855 GGCGTGGGCCACCGTGCCTGTGG - Intronic
1132105426 15:99059372-99059394 CGCCTGGCTCCCCGCGCCTGGGG - Intergenic
1135019147 16:18949010-18949032 CAGGTGGATCACCTCCCCTGAGG + Intergenic
1137873357 16:51971910-51971932 CAGATGGGTAACCGGGCCTGTGG - Intergenic
1141426851 16:83949743-83949765 CATGTGGGGCACTGCTCCTGAGG + Intronic
1142326138 16:89415899-89415921 CATGTGGGTCACGGCGCCTCTGG + Intronic
1152545867 17:80999879-80999901 CATGGGGGTCCCCGCGGCTGGGG + Exonic
1155114015 18:22746945-22746967 CACGTGAGCCACCGTGCCTAGGG - Intergenic
1161155283 19:2729354-2729376 GGCGTGAGCCACCGCGCCTGGGG - Intronic
1163697039 19:18769217-18769239 CCCGTTGGGCACAGCGCCTGGGG + Intronic
934764626 2:96873826-96873848 AGCTTGGGTCAGCGCGCCTGGGG + Intergenic
936032195 2:109081448-109081470 CACATGGGGCTCCGCGTCTGTGG + Intergenic
1184667981 22:45998505-45998527 CGCCTGGGTCACTGCTCCTGCGG + Intergenic
969600054 4:8170891-8170913 CCCATGGGTCACTGTGCCTGTGG - Intergenic
980998950 4:139809559-139809581 CACGTCAGTCACGGGGCCTGGGG + Intronic
985821366 5:2163106-2163128 CAAGTGAATCACCGCTCCTGTGG - Intergenic
1002541499 5:179908885-179908907 CACCTGGGACAACGGGCCTGGGG + Intergenic
1006119055 6:31792966-31792988 TACGTGAGTCACCAGGCCTGGGG - Exonic
1006393513 6:33772546-33772568 CAGGAGGGTCACCAGGCCTGCGG - Exonic
1010585214 6:77650480-77650502 CACGTGGAACCCCGCCCCTGGGG + Intergenic
1018812443 6:167307773-167307795 CACGTGGGTCACCGCGCCTGGGG - Exonic
1034359921 7:150485795-150485817 GGCGTGAGCCACCGCGCCTGGGG + Intergenic
1036529644 8:9571741-9571763 GACGTGAGCCACCGCGCCCGGGG + Intronic
1037828925 8:22176971-22176993 TACGTGGGTCGCCGCGGCGGGGG + Exonic
1044701296 8:94967659-94967681 GACGTGAGCCACCGCGCCCGTGG - Intronic
1045340598 8:101251027-101251049 CACGTGGGTCAACGTTCCCGGGG + Intergenic
1060216923 9:121744018-121744040 CACAGGGGACACCGCGCCTGGGG - Intronic
1061262858 9:129489605-129489627 GGCGTGAGCCACCGCGCCTGGGG + Intergenic
1185877451 X:3712745-3712767 CCTGCGGGTCACCTCGCCTGGGG - Intronic
1185890268 X:3816217-3816239 CCTGTGGGTCACCTCGCCTGGGG - Intergenic
1185894004 X:3842992-3843014 CCTGTGGATCACCTCGCCTGGGG - Intronic
1185899121 X:3881416-3881438 CCTGTGGGTCACCTCGCCTGGGG - Intergenic
1185904238 X:3919845-3919867 CCTGTGGGTCACCTCGCCTGGGG - Intergenic