ID: 1018812620

View in Genome Browser
Species Human (GRCh38)
Location 6:167308607-167308629
Sequence TAGGGGCCCCAGCCCCAGCA AGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 337
Summary {0: 1, 1: 0, 2: 2, 3: 26, 4: 308}

Found 13 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1018812620_1018812634 11 Left 1018812620 6:167308607-167308629 CCTTGCTGGGGCTGGGGCCCCTA 0: 1
1: 0
2: 2
3: 26
4: 308
Right 1018812634 6:167308641-167308663 TGGGGGGAGTGCAGAGGAGTGGG 0: 1
1: 0
2: 6
3: 81
4: 687
1018812620_1018812627 -6 Left 1018812620 6:167308607-167308629 CCTTGCTGGGGCTGGGGCCCCTA 0: 1
1: 0
2: 2
3: 26
4: 308
Right 1018812627 6:167308624-167308646 CCCCTAAGAAGGCGGCCTGGGGG 0: 1
1: 0
2: 0
3: 9
4: 117
1018812620_1018812625 -7 Left 1018812620 6:167308607-167308629 CCTTGCTGGGGCTGGGGCCCCTA 0: 1
1: 0
2: 2
3: 26
4: 308
Right 1018812625 6:167308623-167308645 GCCCCTAAGAAGGCGGCCTGGGG 0: 1
1: 0
2: 0
3: 9
4: 134
1018812620_1018812631 5 Left 1018812620 6:167308607-167308629 CCTTGCTGGGGCTGGGGCCCCTA 0: 1
1: 0
2: 2
3: 26
4: 308
Right 1018812631 6:167308635-167308657 GCGGCCTGGGGGGAGTGCAGAGG 0: 1
1: 0
2: 6
3: 98
4: 3059
1018812620_1018812637 20 Left 1018812620 6:167308607-167308629 CCTTGCTGGGGCTGGGGCCCCTA 0: 1
1: 0
2: 2
3: 26
4: 308
Right 1018812637 6:167308650-167308672 TGCAGAGGAGTGGGGTGGAGTGG No data
1018812620_1018812635 12 Left 1018812620 6:167308607-167308629 CCTTGCTGGGGCTGGGGCCCCTA 0: 1
1: 0
2: 2
3: 26
4: 308
Right 1018812635 6:167308642-167308664 GGGGGGAGTGCAGAGGAGTGGGG No data
1018812620_1018812638 28 Left 1018812620 6:167308607-167308629 CCTTGCTGGGGCTGGGGCCCCTA 0: 1
1: 0
2: 2
3: 26
4: 308
Right 1018812638 6:167308658-167308680 AGTGGGGTGGAGTGGCAAGTCGG 0: 1
1: 0
2: 6
3: 50
4: 514
1018812620_1018812636 15 Left 1018812620 6:167308607-167308629 CCTTGCTGGGGCTGGGGCCCCTA 0: 1
1: 0
2: 2
3: 26
4: 308
Right 1018812636 6:167308645-167308667 GGGAGTGCAGAGGAGTGGGGTGG 0: 1
1: 0
2: 21
3: 397
4: 3440
1018812620_1018812629 -5 Left 1018812620 6:167308607-167308629 CCTTGCTGGGGCTGGGGCCCCTA 0: 1
1: 0
2: 2
3: 26
4: 308
Right 1018812629 6:167308625-167308647 CCCTAAGAAGGCGGCCTGGGGGG 0: 1
1: 0
2: 0
3: 8
4: 130
1018812620_1018812623 -9 Left 1018812620 6:167308607-167308629 CCTTGCTGGGGCTGGGGCCCCTA 0: 1
1: 0
2: 2
3: 26
4: 308
Right 1018812623 6:167308621-167308643 GGGCCCCTAAGAAGGCGGCCTGG 0: 1
1: 0
2: 0
3: 7
4: 143
1018812620_1018812639 29 Left 1018812620 6:167308607-167308629 CCTTGCTGGGGCTGGGGCCCCTA 0: 1
1: 0
2: 2
3: 26
4: 308
Right 1018812639 6:167308659-167308681 GTGGGGTGGAGTGGCAAGTCGGG No data
1018812620_1018812624 -8 Left 1018812620 6:167308607-167308629 CCTTGCTGGGGCTGGGGCCCCTA 0: 1
1: 0
2: 2
3: 26
4: 308
Right 1018812624 6:167308622-167308644 GGCCCCTAAGAAGGCGGCCTGGG 0: 1
1: 0
2: 0
3: 7
4: 118
1018812620_1018812633 10 Left 1018812620 6:167308607-167308629 CCTTGCTGGGGCTGGGGCCCCTA 0: 1
1: 0
2: 2
3: 26
4: 308
Right 1018812633 6:167308640-167308662 CTGGGGGGAGTGCAGAGGAGTGG 0: 1
1: 0
2: 10
3: 127
4: 1130

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1018812620 Original CRISPR TAGGGGCCCCAGCCCCAGCA AGG (reversed) Intronic
900116495 1:1031441-1031463 TTGAGGCCCCAGGCCCAGCCAGG - Intronic
900532991 1:3163823-3163845 TAAGGGAGCCACCCCCAGCAAGG + Intronic
900621833 1:3591076-3591098 GAGGGGCTCCAGCACCTGCAGGG + Intronic
900651109 1:3730513-3730535 CAGGGGCCCCAGCACAAGCCGGG + Intronic
900758534 1:4454636-4454658 TGGAAGCCCCAGACCCAGCATGG + Intergenic
901067660 1:6502090-6502112 TAAGAGGTCCAGCCCCAGCATGG - Intronic
901087475 1:6620160-6620182 TCGGAGTCCCAGCCCGAGCAGGG - Exonic
901302986 1:8212990-8213012 GAGGTGTCCCAGCCCCAGCATGG - Intergenic
901824395 1:11851255-11851277 CAGGGGCCCCAGGCCAAGCAGGG - Intergenic
904044694 1:27602540-27602562 CCGGGGACCCAGACCCAGCAGGG + Intronic
904083097 1:27884428-27884450 GAGTGGTCTCAGCCCCAGCAGGG + Intronic
904301655 1:29558182-29558204 TCCAGGCCCCAGCCCCTGCAAGG - Intergenic
904403438 1:30271766-30271788 TCCAGGCCCCAGCCCCTGCAAGG + Intergenic
904679002 1:32215843-32215865 TAGCAGCCCCAGCCCCAGGCTGG - Exonic
905242211 1:36588586-36588608 CAGGAGCACCAGCCCCACCAGGG - Intergenic
905302358 1:36994057-36994079 TAGGGGACCCAGCCCATGCATGG + Intronic
905957659 1:42012407-42012429 TAAGGGCTCCAGCCCCATCATGG - Intronic
906062579 1:42958322-42958344 CTGTGTCCCCAGCCCCAGCAGGG + Intronic
906480901 1:46198340-46198362 TAGGGGCCCCGGGCCCCGCTCGG + Intronic
906510015 1:46405535-46405557 CAGGGGCACCGGTCCCAGCATGG + Intronic
906760132 1:48369481-48369503 TAGGTGCCCCTCCCCCAGCCTGG + Intronic
906823774 1:48956704-48956726 TAGGGGCCGCAGCCATAGAAAGG + Intronic
907243504 1:53093288-53093310 TGGGTCCCCCAGCCCCAGCCAGG - Intronic
907319525 1:53593949-53593971 CAGGGGCCACATCCACAGCATGG + Intronic
911196721 1:95002281-95002303 AAGCGGCCCCAGCAGCAGCATGG + Intronic
911299704 1:96157276-96157298 CATGTGCCCCAGCCCCAGCTGGG + Intergenic
914913034 1:151802015-151802037 GAGCTGCCCCAGCCCCCGCAGGG + Exonic
915106587 1:153538515-153538537 GAGGGGCCACAGGTCCAGCAGGG - Intronic
915508073 1:156369837-156369859 TAGGGGCTCCACCCTGAGCATGG + Intronic
915595558 1:156894641-156894663 CAGGAGCCCAGGCCCCAGCAAGG + Intronic
917817675 1:178726057-178726079 CAGGGGCCGCAGCCCCAGGTCGG + Intronic
919912914 1:202122962-202122984 CAGGGGCCACAGCCACCGCATGG - Exonic
922748332 1:228059581-228059603 TAGGAGCCCCACCCCCAGGGAGG - Exonic
922796705 1:228343089-228343111 CTGGGTCCCCAGCTCCAGCACGG - Intronic
1063372551 10:5531298-5531320 CAGCGGCCCCAGCACCTGCATGG - Intergenic
1068551076 10:58408606-58408628 AAAGGGCCCCAGTTCCAGCAGGG + Intergenic
1069917906 10:71798525-71798547 TGGGGGCACCAGGTCCAGCAGGG - Exonic
1072572718 10:96672749-96672771 AGAGGGCCCCAGCCCCAGCTGGG - Intronic
1073480901 10:103785494-103785516 TAGGGCCCCCGGGCACAGCATGG + Intronic
1074182589 10:111077327-111077349 AGTGTGCCCCAGCCCCAGCAGGG + Exonic
1074532931 10:114309440-114309462 TTGGGGTCCCCACCCCAGCAGGG - Intronic
1074536239 10:114330241-114330263 AGGGGGTCCCAGCCCCAGAATGG - Intronic
1074747400 10:116548600-116548622 TAGGAACTCCAGGCCCAGCAGGG - Intronic
1075073756 10:119336588-119336610 CAGGGGCCCCAGACTCATCAGGG - Intronic
1075467646 10:122663568-122663590 AAGGGTCCCCAGCCCAAGCTTGG - Intergenic
1075686024 10:124365711-124365733 CAGGGCCCCCGGCCTCAGCACGG + Intergenic
1075734300 10:124654633-124654655 CAGGGTCCCCACCCCCAGCTCGG + Intronic
1076342333 10:129758334-129758356 CAGGGGCTCCAGCCCCTCCAGGG - Intronic
1076522392 10:131089316-131089338 GATGGGCCCCAGCCCCAACGTGG + Intergenic
1076769224 10:132654060-132654082 TCGGGGCCTCAGACACAGCACGG - Intronic
1076817583 10:132922430-132922452 TGGGTGCTGCAGCCCCAGCATGG - Intronic
1077297272 11:1832103-1832125 TAGGGCCCCCAGCCCCCACCAGG - Intronic
1078937774 11:15966587-15966609 AAGGGGCCTGAGCCCCATCACGG + Exonic
1080933510 11:36838005-36838027 GCGGAGCCTCAGCCCCAGCAAGG - Intergenic
1081794888 11:45812259-45812281 TAGGGGCGCCAGACACAGCTGGG - Exonic
1083306845 11:61765905-61765927 CCAGGACCCCAGCCCCAGCAGGG - Intronic
1083412600 11:62504700-62504722 AAGGTTCCCCAGCCCCAGCCAGG - Intronic
1084642684 11:70435160-70435182 TAGGGCCCCCAGCCCCCCCCCGG + Intronic
1084684891 11:70687760-70687782 TGGGGGCCCCTGCCCCATCCAGG + Intronic
1084891076 11:72237481-72237503 CACGGGCCTCAGCCCCACCACGG - Exonic
1085677114 11:78533131-78533153 CTGGAGCCCCAGCACCAGCATGG + Intronic
1089604552 11:119634385-119634407 CAGGGGCCACATCCCCAGGAAGG + Intronic
1092218925 12:6700189-6700211 GCCGGGCCCCAGCCCCAGCGTGG + Exonic
1092826115 12:12400470-12400492 GAGGGGCCTTAGACCCAGCAGGG + Intronic
1096293810 12:50365939-50365961 TGTGGGCCCTCGCCCCAGCAAGG + Intronic
1096499151 12:52054913-52054935 CACCGGCCCCAGCCCCAGCCTGG + Exonic
1096688916 12:53307596-53307618 TAGAGCCTCCACCCCCAGCAGGG + Exonic
1096782727 12:54000426-54000448 TACGGCCCCCAGCCCCACCTCGG + Exonic
1096928285 12:55173496-55173518 CAGGTGCCCCAGCCCCAGCTGGG - Intergenic
1103569100 12:121832305-121832327 CAGGAGCCCCAGCCCCAGAGTGG + Exonic
1103930830 12:124449934-124449956 TAGGAGCCACAGCCCTGGCACGG + Intronic
1105943312 13:25170253-25170275 CAGGGACCCGAGCCCCAGGAGGG - Exonic
1107038870 13:35928222-35928244 TAAGGGCACCATCCCCACCAAGG - Intronic
1108455318 13:50607727-50607749 CAGTGGCCCCAGCACCACCATGG - Intronic
1110423029 13:75335034-75335056 TTGGGGTGGCAGCCCCAGCAGGG - Intronic
1110813858 13:79840087-79840109 CAGGCGCCCCTGCCCCAGCCTGG - Intergenic
1112339053 13:98537574-98537596 CAGGGGCCCCAGCTCCACCCAGG + Intronic
1113890799 13:113734697-113734719 CTGGGGCCCCATCCCCACCAGGG - Intronic
1114221250 14:20699418-20699440 GACCAGCCCCAGCCCCAGCAGGG - Exonic
1118769152 14:68929937-68929959 GAGGGGCCCCAGCCCAGGCTAGG + Intronic
1121409091 14:93737175-93737197 TAGGAGCCCCAAGCCCAGCTGGG + Intronic
1121410468 14:93745478-93745500 TCAGGCCCCCAGCCCCAGCCTGG + Intronic
1121617040 14:95320054-95320076 TCAGGGCCCCCGCCCCCGCACGG - Intergenic
1122465818 14:101932797-101932819 AAGAGGCTCCAGCCTCAGCATGG - Intergenic
1122470404 14:101962290-101962312 GAGGGGCCCTACCCCCACCAGGG + Intergenic
1122511043 14:102267816-102267838 TTGAGGACCCAGCTCCAGCATGG - Intronic
1122816619 14:104317126-104317148 CAGGGGCCCCAGCTGCAGGATGG - Intergenic
1122839096 14:104446107-104446129 AAGGGGCCCCAAGCACAGCAGGG - Intergenic
1122889222 14:104724804-104724826 CAGAGGACCCAGCCCCAGGATGG + Intronic
1123008680 14:105336673-105336695 TAGGGCCCACAACCCCAGGAAGG - Intronic
1123424935 15:20163553-20163575 TAAGGGCCCAAGCCACAGTAGGG - Intergenic
1123534159 15:21170086-21170108 TAAGGGCCCAAGCCACAGTAGGG - Intergenic
1124527490 15:30470954-30470976 TTTGGGCTCCAGCCCCAGCCGGG - Intergenic
1124771163 15:32536729-32536751 TTTGGGCTCCAGCCCCAGCCGGG + Intergenic
1125758171 15:42079785-42079807 TAGGAGCCCGAGGCCCAGCATGG + Intronic
1125882791 15:43208547-43208569 CAGGAGCCCCACCCCCTGCATGG - Intronic
1127303981 15:57684082-57684104 GAGAGGCCCCAGGCCCAGCGTGG - Intronic
1128084024 15:64873686-64873708 TACGGGCGCCCGCCCCAGGATGG + Intronic
1128734537 15:70045601-70045623 AGGTGGCCCCAACCCCAGCATGG - Intergenic
1129242291 15:74258903-74258925 CTGGGGCCCCCACCCCAGCAGGG - Intronic
1129344801 15:74910337-74910359 GAGAAGCCCCAGGCCCAGCAAGG - Intergenic
1129399054 15:75269276-75269298 CAGAGGCCCCAGCCCCAGGGAGG + Intronic
1129402661 15:75293552-75293574 CAGAGGCCCCAGCCCCAGGGAGG + Intronic
1129650478 15:77483730-77483752 ATGGAGTCCCAGCCCCAGCAAGG + Exonic
1129653882 15:77510128-77510150 TAGGGTCACAAGCCCCACCAAGG - Intergenic
1129728477 15:77916084-77916106 CAGAGGCCCCAGCCCCAGGGAGG - Intergenic
1129961753 15:79692726-79692748 CAGGGTCCCCAGCCTCACCAGGG + Intergenic
1130682601 15:86009831-86009853 CAGGGGACCCAGCCCCAGTAAGG + Intergenic
1132201321 15:99956501-99956523 AAGGACCCCCAGCCCCACCAGGG - Intergenic
1132694534 16:1195979-1196001 GAGGGGCCGCAGCACCCGCACGG - Exonic
1132831410 16:1930047-1930069 CAGGGGCCACAGCCCCACCAGGG + Intergenic
1132850678 16:2023669-2023691 TAGTGGCCCCACCCCCAGACAGG + Intergenic
1132973639 16:2701017-2701039 CCAGGGCCCCAGCCCCACCAAGG - Intronic
1133130125 16:3671673-3671695 TAGGGGCCTTGTCCCCAGCAGGG + Intronic
1134135875 16:11676068-11676090 TATGGACCACAGCCCCACCACGG + Exonic
1134855806 16:17518063-17518085 TACAGAACCCAGCCCCAGCAAGG + Intergenic
1135247990 16:20873680-20873702 TATGGGACTCAGCCCCACCAAGG + Intronic
1135304280 16:21355164-21355186 CACAGGCCCCAGCCCCAGGATGG - Intergenic
1136355829 16:29744476-29744498 TGGGGGCCCCAGCCCTGGGAGGG - Exonic
1136544574 16:30948205-30948227 TGGGGGCGCCAGCCCAAGAATGG + Exonic
1136549927 16:30977603-30977625 TAGGGGGCGCTGCCCCAGCGTGG + Intronic
1136551349 16:30984145-30984167 TGGGGGCCCCAAGCCCAGCGAGG + Exonic
1137365401 16:47855560-47855582 TACTGGCCCCAGCCCAAGGAGGG + Intergenic
1137755637 16:50899927-50899949 CATGGGCCCAGGCCCCAGCATGG + Intergenic
1138403313 16:56767088-56767110 CAAGGGCCTTAGCCCCAGCATGG - Intronic
1138490326 16:57372713-57372735 CAGGGGCCCCAGACCCTGCCTGG + Intronic
1138528429 16:57621866-57621888 TAGGGGTCCCAGCCTTGGCATGG - Intronic
1138599791 16:58047606-58047628 TAGGGGTCGCACCCCCACCACGG + Intergenic
1139274766 16:65717143-65717165 AAAGAGCCCCAGCCCCAGAAAGG + Intergenic
1139590364 16:67929726-67929748 TGGGGGCCCCGGCCTCGGCATGG + Exonic
1139964486 16:70737920-70737942 CATGGACCCCAACCCCAGCAGGG - Intronic
1140056675 16:71531564-71531586 TAGGAGGCCCAGCTCCAGCTTGG + Intronic
1141618168 16:85221817-85221839 TCTGGCCCCCAGCCCCGGCAAGG - Intergenic
1142027950 16:87824452-87824474 CAGGGGTCCCAGCCCGGGCAGGG - Intergenic
1142198048 16:88747888-88747910 GAGGGGCCCCAAGCCCAGGAAGG + Intronic
1142289962 16:89189417-89189439 AAGGGGCTCAAACCCCAGCATGG - Intronic
1142719370 17:1766219-1766241 GTGGGGCCCCAGCCCCAGCAGGG - Intronic
1142864865 17:2784699-2784721 TACGGGCCCCACCCTCAGCAGGG - Intronic
1143621944 17:8085899-8085921 AGGGGGGCCCAGCCCCACCAGGG - Intronic
1145737120 17:27240775-27240797 TCTGGGCCCCAGGCCCAGAATGG + Intergenic
1145996918 17:29110197-29110219 CAGCGGCCCCAGCACCAGCCAGG + Intronic
1147674024 17:42192716-42192738 TAGGGCTGCCAGACCCAGCAAGG + Exonic
1147690597 17:42312506-42312528 CAAGGGCCCCAGCGACAGCAGGG - Intergenic
1147794258 17:43031413-43031435 CAGGGGCTCCAGGCCCAGCTAGG + Intergenic
1148772708 17:50076402-50076424 CAGGGACCGCAGCCCCAGCCGGG - Exonic
1148777642 17:50104710-50104732 CATGGGCCCCAGCCCCACCTGGG + Intronic
1149231868 17:54544386-54544408 TAGTCTCCCCAGCTCCAGCAGGG - Intergenic
1149432925 17:56608852-56608874 TCGTGGTCCCAGCCCCAACAGGG - Intergenic
1150270538 17:63861695-63861717 CAGGGGCCCCAGGGCCACCATGG + Intergenic
1150274210 17:63885538-63885560 CAGGGGCCCCAGGGCCACCATGG + Intergenic
1150276359 17:63900365-63900387 CAGGGGCCCCAGGGCCACCATGG + Intergenic
1150283053 17:63940537-63940559 CAGGGGCCTCAGACCCAGCATGG + Exonic
1150284645 17:63948065-63948087 TGGGGGCACCAGCACCACCAGGG + Intronic
1151540749 17:74763543-74763565 GGGGGGCTCCAGCCCCAGGACGG - Intronic
1151801005 17:76379771-76379793 CTGGGTCCCCAGCCTCAGCAAGG + Intronic
1152030236 17:77837844-77837866 TAGGAGCCTCAACCCCTGCAAGG + Intergenic
1152259861 17:79261000-79261022 GAGAGGCCCCGGCCCCAGGACGG - Intronic
1152274678 17:79349339-79349361 GAGTGACCCCAGACCCAGCAAGG - Intronic
1152430442 17:80245866-80245888 TGGGGCCCCCATACCCAGCAGGG - Intronic
1152461715 17:80445351-80445373 GAGGGGCCTCTGCCCCAGCTGGG + Intergenic
1152536128 17:80951190-80951212 CAGGGACCCCAGGCCCAGCCGGG - Intronic
1152554269 17:81045302-81045324 CTGGGCCCCCAGCCCCAGCCTGG - Intronic
1152587030 17:81193751-81193773 TTGGGGGCCCAGCCTCAGCCGGG - Intronic
1152676747 17:81645218-81645240 CAGGGCCAGCAGCCCCAGCAGGG - Exonic
1154010849 18:10572549-10572571 TAGACTCCCCAGCCACAGCAGGG + Intergenic
1157319564 18:46623854-46623876 TAGGGGGCCCGGCCCCCTCATGG - Intronic
1158640953 18:59203077-59203099 CATGGGTCCCAGCCCCAGCAAGG - Intergenic
1158962861 18:62601088-62601110 GAGGGTCCCCTGCCCTAGCAAGG + Intergenic
1159920318 18:74221672-74221694 TGGGGGTCTCAGGCCCAGCATGG - Intergenic
1160157241 18:76442997-76443019 GCGAGGCCCCAGCCCCACCAGGG - Exonic
1160268194 18:77359023-77359045 GAGGGGCCCCAGCACCCCCAAGG - Intergenic
1160786387 19:901858-901880 TTGGGTCCCCAGCCCCACCCAGG + Intronic
1161102773 19:2429484-2429506 GGGGGGCCCCAGCCCCAGGCCGG - Exonic
1161118190 19:2511157-2511179 TAGGAGCTCCCTCCCCAGCAAGG + Intergenic
1161395929 19:4045001-4045023 TGGGGGCCACAGCCTCTGCATGG - Exonic
1161493397 19:4575024-4575046 TCGACGCCCCAGCCCCAGCCTGG - Intergenic
1161622843 19:5308417-5308439 TAGTGTCCCCAGTCCCAGCATGG + Intronic
1162028712 19:7908342-7908364 TAGGGGGCACAGCTCCTGCAGGG + Intronic
1162958669 19:14113681-14113703 TAGGGGGCCCAGCCCAGGCTGGG - Intronic
1163038770 19:14587473-14587495 CCTGGGCCCCAGCCCCAGCCTGG - Intronic
1163039516 19:14592140-14592162 CCTGGGCCCCAGCCCCAGCCTGG - Intronic
1163126457 19:15246795-15246817 TGGGGGCCCCAGCACTTGCAAGG - Intronic
1163849332 19:19654512-19654534 CTGGGGCCTCAGGCCCAGCAAGG - Intronic
1164412175 19:28015116-28015138 GAGGGCCTCCAGCACCAGCAGGG + Intergenic
1164845019 19:31424616-31424638 TTGGCACCCCAGCCCCACCAGGG + Intergenic
1165060022 19:33200633-33200655 AAGTGGCCCCGGCCCCAGCCTGG - Intronic
1165760166 19:38316228-38316250 TAGGGGCGTGAGCCCCGGCAAGG - Intronic
1165855275 19:38876334-38876356 TAGTGGCCACAGCCCCACAAGGG + Exonic
1165900308 19:39166627-39166649 TAGGGCTCCAAACCCCAGCAGGG - Intronic
1166047711 19:40239074-40239096 TGGGGGCCCCAGCCAGGGCAGGG - Intronic
1167166963 19:47804917-47804939 TCGGGGCCCCAGCCCTGGGAAGG - Intronic
1167742767 19:51334237-51334259 TAGCAGCGCCAGGCCCAGCAGGG + Exonic
1168499937 19:56885012-56885034 TTGGGTCACCTGCCCCAGCAGGG + Intergenic
926115583 2:10210840-10210862 TAAGGGCACCAACCCCAGCATGG - Exonic
927894305 2:26771595-26771617 TAAGGGCCACAGACCCAGCAGGG - Intronic
932319258 2:70809123-70809145 TAGGAGCCACAGCACCAGGAAGG - Exonic
932758820 2:74426414-74426436 CAGTGGCCCCAGCCCCAGACTGG - Exonic
935388049 2:102521934-102521956 TAGGAGCAACAGACCCAGCAGGG - Intronic
937257361 2:120564866-120564888 TTGGAGCCCCTGCCCCAGCTTGG - Intergenic
937452399 2:122012370-122012392 TCTGGGCCCCAGTCCCAGCTGGG - Intergenic
937917475 2:127106192-127106214 GAGGTGCCCTCGCCCCAGCAGGG - Intronic
938276843 2:130033967-130033989 TAGGACCCACTGCCCCAGCAGGG + Intergenic
938327813 2:130424748-130424770 TAGGACCCACTGCCCCAGCAGGG + Intergenic
938362133 2:130696730-130696752 TAGGACCCACTGCCCCAGCAGGG - Intergenic
939237424 2:139515090-139515112 TCTATGCCCCAGCCCCAGCATGG + Intergenic
939995813 2:148918485-148918507 TAGGAGCCCCAACCCCACCCAGG - Intronic
942327836 2:174790571-174790593 CGGGGGCCCCAGCCCCAGACTGG + Intergenic
946330364 2:219005603-219005625 TTGTGCCCCCAACCCCAGCATGG - Intronic
947551665 2:231050904-231050926 TGGGCTCCCCAGCCCCAGCTGGG + Intergenic
947722527 2:232378586-232378608 TCAGGACCCCAGCCCCAGCCCGG + Exonic
948204617 2:236156652-236156674 CAGGGGCCTCATCCCCAGCGTGG - Intergenic
948536710 2:238652280-238652302 GAGGGGCCCCGGCCCCCACAGGG - Intergenic
948809353 2:240466863-240466885 GAGGGGCCCCAGCGTCTGCAGGG + Exonic
1169809729 20:9597171-9597193 TAAGGACCATAGCCCCAGCAAGG - Intronic
1170960329 20:21020004-21020026 TAAGGCCCCCTGCCCCAGCACGG - Intergenic
1171217566 20:23362931-23362953 CAGTGGTCCCAGCCCCAGCCTGG - Intronic
1172142011 20:32729462-32729484 TAAGGGCCCCAGCCCTAGGCTGG - Intronic
1173174592 20:40754781-40754803 TATGGTCCCCCTCCCCAGCAGGG + Intergenic
1173189045 20:40862313-40862335 CTGTGTCCCCAGCCCCAGCACGG - Intergenic
1173196077 20:40913724-40913746 GAGGGGACGCAGCCCCAGCCGGG + Intergenic
1174083720 20:47989751-47989773 GAGGGGTCCCAGCACAAGCAAGG - Intergenic
1174086991 20:48016454-48016476 TGGTGGGCGCAGCCCCAGCAGGG + Intergenic
1174456128 20:50649888-50649910 TCTGGGCTCCAGCCCCAGCCGGG + Intronic
1175816636 20:61886500-61886522 TAGGGGCCCCAGCCCAGGACAGG + Intronic
1175971648 20:62689550-62689572 AGGGGACCCCAGCCCCAGCAGGG + Intergenic
1178095675 21:29212500-29212522 TCTGGGCCCCAGCAACAGCACGG - Intronic
1179956285 21:44740952-44740974 TATGCACCCCAGCCCCAGCTGGG - Intergenic
1180741853 22:18059014-18059036 TGGGGGCCCCAGATCCAGCCTGG + Intergenic
1181576848 22:23800715-23800737 TAGGGGCACCAGACACAGCACGG - Intronic
1181672855 22:24433860-24433882 ACGGGGCCCCAGGCTCAGCAGGG + Intronic
1182394681 22:30026682-30026704 TAGGGGACCAGGCCCCAGAATGG - Exonic
1183079001 22:35444429-35444451 CATCAGCCCCAGCCCCAGCAGGG - Intergenic
1183831034 22:40418484-40418506 TCAGGGCCCCAGCCTCATCAAGG - Exonic
1183834607 22:40441938-40441960 CAGGGGCCCCAGGGCCAGAATGG + Intronic
1184692878 22:46125301-46125323 CACGGGCCCCAGCCTCAGCAGGG + Intergenic
950519074 3:13485494-13485516 TAGGCCCCCCACCCCCAGCCTGG - Intronic
950653782 3:14424223-14424245 CAGGGTCCCTAGCCCCAGCTGGG - Intronic
953537292 3:43786178-43786200 TTGGGGGCCCATGCCCAGCAGGG - Intergenic
954609561 3:51937158-51937180 TGGGGGCTCCAGCCCCACCCAGG + Intronic
957952241 3:87141619-87141641 CATGTGTCCCAGCCCCAGCATGG - Intergenic
959920517 3:111863132-111863154 TGGGTGCCCCAGTCCCAGAAAGG + Intronic
962482074 3:135806624-135806646 GAGAGCCCCCAGGCCCAGCAAGG - Intergenic
963357840 3:144232555-144232577 TAGGGGCCCTAATCCCATCAAGG - Intergenic
964622538 3:158731977-158731999 CAGGGGCGCCAGGCCCAGCTGGG + Intronic
966888274 3:184388592-184388614 TCGGGGGCCCACCCCCAGCTGGG + Exonic
967857522 3:194129613-194129635 CATATGCCCCAGCCCCAGCATGG + Intergenic
968515324 4:1013222-1013244 CCTGGGACCCAGCCCCAGCAAGG + Intronic
968518186 4:1023541-1023563 TAGCTCCCCCAGCCCCAGCCGGG - Intronic
968830583 4:2931388-2931410 CAGCAGCCCCAGGCCCAGCACGG + Exonic
968904433 4:3444960-3444982 ATGGGGGCCCAGGCCCAGCAGGG - Exonic
969075880 4:4577263-4577285 GAGGTGCCCCACCCCTAGCATGG - Intergenic
969431043 4:7154498-7154520 TAGGGACCCCAGACCCACCACGG - Intergenic
972335793 4:38106419-38106441 AATGGGCCCCAGCTCCACCAAGG - Intronic
972725818 4:41745944-41745966 CAGGGCCCCCAGCCGCAGCCAGG + Exonic
972822436 4:42717030-42717052 TAGGGACCCCAGCACCAGCTGGG - Intergenic
975582758 4:75921637-75921659 TAGGGGTCCCATCCTCACCAAGG + Intronic
977607414 4:98996179-98996201 TGGCGGCCCCCGCCCCAGCGCGG - Intronic
982638557 4:157927352-157927374 TAGGCGCCCCTCCCCCAGCCTGG + Intergenic
987890022 5:23864496-23864518 CATGAGTCCCAGCCCCAGCAGGG - Intergenic
988555518 5:32232741-32232763 TAGGGGCCGCAGGCCCAGGGTGG - Intronic
989201731 5:38770603-38770625 GGAGAGCCCCAGCCCCAGCATGG + Intergenic
997459265 5:134041341-134041363 GAGGGGCCACAGGCCCAGGAGGG + Intergenic
997879420 5:137576117-137576139 TAGGGAGGCCAGCCCCAGCTTGG - Intronic
998269170 5:140691346-140691368 TGGTTGCCCCAGCCTCAGCAAGG + Exonic
999247261 5:150161799-150161821 TGGCGGCCCCAGCCCCTGGAGGG + Intergenic
999687669 5:154117213-154117235 GAGGGGACCCACACCCAGCAGGG + Intronic
1003238776 6:4323120-4323142 TATGGGACCCAGCCCCACCTTGG + Intergenic
1003279183 6:4677183-4677205 TGGGGGCGCTGGCCCCAGCAGGG + Intergenic
1006619727 6:35355102-35355124 TAGGGAGCCCAGCCTCAGCCTGG + Intronic
1006826441 6:36939379-36939401 TGGGGGCCTGAGGCCCAGCAAGG + Intergenic
1007627439 6:43254498-43254520 TGGGGGCCCCAACCCCAGCTGGG - Intronic
1012423917 6:99093996-99094018 GAGGGGAACAAGCCCCAGCAAGG + Intergenic
1013174081 6:107662526-107662548 AGGGGGCGCCTGCCCCAGCAGGG - Intergenic
1013432118 6:110064586-110064608 TGGGTGCCCCAGCCCCAGCAGGG + Intergenic
1015009005 6:128320827-128320849 CAGGGTCCACAGCCCCAGGAGGG - Intronic
1016162414 6:140898001-140898023 CATGCGTCCCAGCCCCAGCAGGG + Intergenic
1016395205 6:143616972-143616994 TAGGGGCCTCAGACCAATCAGGG + Intronic
1017719064 6:157232439-157232461 GAGGGGCCCCAGCCCAAGGCAGG + Intergenic
1018174457 6:161166904-161166926 CAGGAGCCCCAGCACCTGCAGGG + Intronic
1018647238 6:165959961-165959983 TAGCTGCACCAGCCACAGCAAGG + Intronic
1018812620 6:167308607-167308629 TAGGGGCCCCAGCCCCAGCAAGG - Intronic
1018845498 6:167552495-167552517 CACGGGCTCCAGCACCAGCACGG - Intergenic
1019065066 6:169289525-169289547 TAGAGTCCTCAGCCCCAGGAGGG + Intergenic
1023811482 7:43915576-43915598 CATGAGCCCCAGCCCCAGCTGGG - Intronic
1024491082 7:49986404-49986426 CATGGGCCCCAGCCCCAGCTGGG - Intronic
1024655257 7:51446567-51446589 TATGCATCCCAGCCCCAGCAGGG - Intergenic
1029585535 7:101468477-101468499 AAGGTGCCCCTTCCCCAGCAGGG - Intronic
1032250956 7:130256792-130256814 TGGGAGCCCCAGCCCCAGCCAGG - Intergenic
1033245431 7:139713393-139713415 TAGGGGCACCAGCACCAGGCAGG + Intronic
1034444876 7:151108724-151108746 TAGAGGCCCAAGCTCCAGCCTGG + Intronic
1034448977 7:151127397-151127419 AAGGGGCAGCACCCCCAGCAGGG - Intronic
1035335407 7:158124783-158124805 TACAGACCCCAGCCCCAGCGTGG - Intronic
1035577583 8:717704-717726 TGGCTGCCCCAGGCCCAGCAAGG - Intronic
1035657195 8:1319154-1319176 TGGGGGCCCCAGGCACTGCAGGG - Intergenic
1037249597 8:16877139-16877161 CAGTGCCCCCAGCACCAGCAAGG + Intergenic
1037714060 8:21382076-21382098 TAAGGCCACCAGCCCCATCATGG + Intergenic
1037980005 8:23246674-23246696 TCGGAACCCCAGCCCCGGCAAGG - Exonic
1038455777 8:27671158-27671180 TAGGGCCCCCAGGGCCAGAAGGG + Exonic
1039609027 8:38904288-38904310 CAGGAGCCCCTGCCCCAGCAGGG - Intronic
1042859649 8:73299285-73299307 CTGGGGACCCAGCCACAGCAAGG - Intronic
1044082585 8:87903899-87903921 TTGGGGCCCCAACCCCTGCATGG - Intergenic
1047303885 8:123637703-123637725 TAGGGCCCCCCTTCCCAGCATGG - Intergenic
1049463970 8:142742749-142742771 TAGGCCACCCAGCCCCAGCCTGG + Intergenic
1049605595 8:143527883-143527905 TAGGGCACCGAGCACCAGCAAGG + Intronic
1049677837 8:143900667-143900689 CAGGAGCCCCAGCCCCACCCTGG - Intergenic
1049820462 8:144630163-144630185 CTGGTGCCCCAGCCCCAGCTAGG + Intergenic
1051332633 9:16039267-16039289 TAGGGGCCTCAGCCACATGAGGG - Intronic
1053142202 9:35689305-35689327 GAGGGGGCCCAGGCCCAGAATGG + Intronic
1053391607 9:37740238-37740260 GAGGGGCCCCAGCACCTGCGGGG + Exonic
1054337301 9:63818054-63818076 CTGGGGCTCCAGCCCCACCACGG + Intergenic
1056535531 9:87524336-87524358 AGGGGGTCCCAGACCCAGCATGG - Intronic
1057258020 9:93566858-93566880 TGGGAGCCCGAGTCCCAGCAAGG + Intergenic
1057312625 9:93951681-93951703 TAGGGGCCCCAGCGACATCGGGG + Exonic
1057726599 9:97572575-97572597 CAGGTGCCCCAGCCCCAGGCTGG + Intronic
1058453615 9:105119276-105119298 GAGTGGCCCGAGCCCCAGCCAGG + Intergenic
1059424328 9:114211206-114211228 TGGAAGCCCCAGCCCCAGCCAGG - Intronic
1060587885 9:124797936-124797958 AAGGAGCCAGAGCCCCAGCAAGG + Intronic
1061181302 9:129026684-129026706 GCAGGGCCCCAGCCCTAGCAGGG + Intronic
1061626907 9:131845955-131845977 AGGGGGCCCCAGCCCCGGCTGGG + Intergenic
1061652913 9:132065694-132065716 TATGGGGCCCAGCCCGGGCATGG - Intronic
1062081714 9:134627622-134627644 AAGGGGCCTCAGCAGCAGCAGGG - Intergenic
1062345784 9:136114445-136114467 CAGGGGCTCCTTCCCCAGCACGG + Intergenic
1062532485 9:137008009-137008031 AAGTGTCCTCAGCCCCAGCAGGG - Intronic
1062582879 9:137236175-137236197 GAGGAGCACCAGCCCCACCAGGG - Exonic
1062601338 9:137319912-137319934 CAGGGTCCCCAGCCCCAACAAGG + Intronic
1203364147 Un_KI270442v1:243036-243058 CTGGGGCTCCAGCCCCACCACGG - Intergenic
1203377203 Un_KI270442v1:385375-385397 CTGGGGCTCCAGCCCCACCACGG + Intergenic
1185750982 X:2609429-2609451 GAGGAGCCGCAGCGCCAGCACGG - Intergenic
1190732122 X:53233330-53233352 TGGGTGCCCCTGCCCCAGCGAGG + Exonic
1191768851 X:64733162-64733184 CAGTGTCCCCAGCACCAGCAGGG + Intergenic
1192318398 X:70068589-70068611 TACCAGCCCCACCCCCAGCAAGG - Intergenic
1192436205 X:71145237-71145259 GAGGGCCCCCAGCCCCATCCCGG + Intronic
1192727519 X:73768331-73768353 CAGGTGCCCCTCCCCCAGCAAGG - Intergenic
1195569083 X:106379329-106379351 TAATGGCTCCAGCCACAGCAAGG + Intergenic
1197871634 X:131067517-131067539 TAGGGGCCGCGACCCCGGCAGGG - Intronic
1199762470 X:150915666-150915688 TAAGGGCACCAGTCCCATCAAGG - Intergenic
1200108001 X:153725091-153725113 CAGGGGCCCCAGCACCACCCCGG + Exonic