ID: 1018812898

View in Genome Browser
Species Human (GRCh38)
Location 6:167310201-167310223
Strand -
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 204
Summary {0: 2, 1: 0, 2: 0, 3: 15, 4: 187}

Found 3 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1018812898_1018812899 13 Left 1018812898 6:167310201-167310223 CCATGACTTATCTGAACTTACAT 0: 2
1: 0
2: 0
3: 15
4: 187
Right 1018812899 6:167310237-167310259 TATTTACACATTAAATGAAAAGG 0: 2
1: 2
2: 1
3: 78
4: 647
1018812898_1018812901 24 Left 1018812898 6:167310201-167310223 CCATGACTTATCTGAACTTACAT 0: 2
1: 0
2: 0
3: 15
4: 187
Right 1018812901 6:167310248-167310270 TAAATGAAAAGGAGAACACTGGG 0: 2
1: 0
2: 2
3: 41
4: 555
1018812898_1018812900 23 Left 1018812898 6:167310201-167310223 CCATGACTTATCTGAACTTACAT 0: 2
1: 0
2: 0
3: 15
4: 187
Right 1018812900 6:167310247-167310269 TTAAATGAAAAGGAGAACACTGG 0: 2
1: 0
2: 5
3: 37
4: 531

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1018812898 Original CRISPR ATGTAAGTTCAGATAAGTCA TGG (reversed) Intronic
902432837 1:16376873-16376895 ATCTGAGTTCAGATCAGTCTGGG - Intronic
903447496 1:23431637-23431659 ATGGATGCTCAGAGAAGTCAGGG + Intronic
905097557 1:35486933-35486955 ATGTATGTTCAGATAATTAAAGG - Intronic
905289070 1:36909068-36909090 ATGGAAGTCCAGGGAAGTCAAGG + Intronic
906171935 1:43733717-43733739 ATCCAAGTTCAGAAAATTCATGG + Intronic
908723090 1:67147228-67147250 AGGTAACTTCAGGTATGTCAGGG - Intronic
910251692 1:85204621-85204643 ATGAAAATTGAGATAAGTGAGGG - Intergenic
910587124 1:88892123-88892145 ATGTAAGTTTATATAGGTTATGG + Intergenic
914855623 1:151348157-151348179 ATCTAATTTCAGAGAGGTCATGG + Intergenic
914886681 1:151590766-151590788 ATGTAAGTTCTGTCAAGGCAGGG + Intergenic
915010184 1:152678166-152678188 ATGGAAGTTTAGATAAGGAAAGG - Intergenic
916781777 1:168039972-168039994 ATGTAAGTTCCAATAAGGCAGGG - Intronic
917020871 1:170585353-170585375 ATTGAAGTTCAGGGAAGTCAAGG + Intergenic
917213007 1:172649074-172649096 ATGCAAGTTCATGGAAGTCATGG + Intergenic
917386277 1:174479136-174479158 ATGTAAGTTCTGATTAAGCAGGG + Intronic
918620943 1:186605223-186605245 ATGCAAGTACAGAAAAGTCAAGG - Intergenic
918885003 1:190181384-190181406 ATGTAATTTTAGATATGTTAAGG + Intronic
920293958 1:204944481-204944503 AGGAAAGTTCAGATAATCCAAGG + Intronic
923271118 1:232355832-232355854 ATGCAAGTGCAGAGAAGACAAGG - Intergenic
923461207 1:234211126-234211148 CTGCAAGTGCAGAGAAGTCAAGG + Intronic
1065511627 10:26484598-26484620 ATGTAAGTTCAAAAAAGGCCTGG - Intronic
1070633442 10:78105211-78105233 ATAAAAGTTCAGAAAATTCACGG + Intergenic
1071270450 10:84001948-84001970 ATGGAAGCTCAGAGAAGGCAGGG - Intergenic
1073689687 10:105794088-105794110 ATGTAAGTTCCTTGAAGTCAGGG + Intergenic
1073838633 10:107472674-107472696 ATGTAAATACAGATAATTCAAGG - Intergenic
1074482488 10:113837388-113837410 GTTTAACTTCAGATAAGTAAAGG - Intronic
1076031812 10:127165796-127165818 AAGTAATTTCAGACAAATCAAGG - Intronic
1080195959 11:29609224-29609246 ATGTAAGTTCAGTGAGGGCAGGG - Intergenic
1080215296 11:29832861-29832883 ATGAAATTTCAGAAGAGTCAAGG + Intergenic
1080999690 11:37653593-37653615 ATGAAAGTACAGATAACTCTTGG - Intergenic
1081036640 11:38155820-38155842 ATGTAAGTTTTGATAGGTGAGGG - Intergenic
1081175638 11:39923386-39923408 ATATATTTTCAGGTAAGTCATGG - Intergenic
1081490128 11:43561158-43561180 ACCTAAGTACAGATCAGTCAGGG - Intronic
1083416927 11:62531939-62531961 ATGTAAGTCCACATCAGGCATGG + Exonic
1086274689 11:85112087-85112109 CTGTAAGATCACATGAGTCAAGG + Intronic
1093859892 12:24152177-24152199 ATGAAAGTTGACATATGTCATGG + Intergenic
1093865456 12:24221951-24221973 AAGTGAGGTCAGATAAGCCAGGG + Intergenic
1098098522 12:66987209-66987231 ATGTAAGTTCTGTGAAGACAAGG + Intergenic
1098593674 12:72244767-72244789 ATGTAAGTTCAGAGAAAAAAAGG + Intronic
1098996121 12:77122750-77122772 ATATAAGTTCTAATAAGGCAAGG - Intergenic
1099445542 12:82747320-82747342 ATAGAAGTTCAGAGAAGTTAAGG + Intronic
1100181272 12:92088718-92088740 ATCTAAGCTCAGACAAATCAGGG - Intronic
1100275806 12:93070779-93070801 GTGTTAGTTCAGATAAGCCATGG + Intergenic
1100706493 12:97205609-97205631 ATGTGAGTTCTTATAAGTTAGGG - Intergenic
1101489007 12:105194837-105194859 CTGTATGTTCAGATAAGGCGTGG + Intronic
1101721987 12:107358468-107358490 ATATAAGTTCAGACAGGTAATGG + Intronic
1103128472 12:118445835-118445857 ATGTAAGTGCAGTAAATTCAAGG - Intergenic
1104122689 12:125814306-125814328 ATGTAAGTTCAAAGAAAGCAGGG - Intergenic
1104459720 12:128945421-128945443 ATGTGAGTTCAGGTAACCCAGGG - Intronic
1105741527 13:23329118-23329140 ATGTCAGTTCTGATCATTCATGG + Exonic
1105764113 13:23541569-23541591 ATGTAAGTTCTAAAAGGTCAGGG + Intergenic
1106251314 13:27983728-27983750 ATGTAAGCTCATTTAAGGCAAGG + Intronic
1107248747 13:38331082-38331104 ATCTAAATTCAGCTAAATCATGG + Intergenic
1108201805 13:48051413-48051435 GTGTAAGGTGAGATATGTCAAGG - Intergenic
1110261838 13:73493497-73493519 ATGAAGGTTCACATATGTCATGG - Intergenic
1111200051 13:84924144-84924166 ATGTAATATCAGAAAAGTCCAGG + Intergenic
1113370797 13:109723677-109723699 ATGAAAGTTCATATAAATCAAGG - Intergenic
1116041190 14:39688006-39688028 ATGTATGCTCAGTAAAGTCAGGG + Intergenic
1121985918 14:98505525-98505547 ATTTAAGTTCAGAGAAGAAAAGG + Intergenic
1122729011 14:103781198-103781220 ATTTAAGTATAGATAAGTGAGGG + Intronic
1124701812 15:31920277-31920299 ATGTATGTTCAAAGAACTCAAGG + Intergenic
1127320393 15:57839244-57839266 ATGCAAGTTAAACTAAGTCAAGG + Intergenic
1127484398 15:59405826-59405848 AGGTAAGCCCAGAAAAGTCAAGG - Intronic
1133597238 16:7304460-7304482 CTGTAAGTACATAAAAGTCAAGG - Intronic
1136028158 16:27483335-27483357 ACGGAAGTTCAGAGAAGCCAAGG - Intronic
1136560580 16:31036902-31036924 AAGTAAGATCAGAGAGGTCATGG + Intronic
1136866443 16:33760805-33760827 ATATAAATGCTGATAAGTCATGG + Intergenic
1138988368 16:62360022-62360044 ATGTAAGCTCAATAAAGTCAGGG + Intergenic
1139263227 16:65615716-65615738 ATTTAAGTTCCGTGAAGTCAGGG - Intergenic
1140961822 16:79920881-79920903 GTCAAAGTTCAGAAAAGTCAAGG + Intergenic
1203105718 16_KI270728v1_random:1355398-1355420 ATATAAATGCTGATAAGTCATGG - Intergenic
1203127796 16_KI270728v1_random:1606970-1606992 ATATAAATGCTGATAAGTCATGG + Intergenic
1146026828 17:29328887-29328909 ATGTAAGTTCAGAGAGTTTAAGG - Intergenic
1146307337 17:31740553-31740575 ATGAAAGCTCAGAGAAGTCAAGG + Intergenic
1152826108 17:82465932-82465954 GTGCAAGTGCATATAAGTCAGGG - Intronic
1153583589 18:6599399-6599421 ATGTAAGTTCCATGAAGTCAGGG - Intergenic
1156526954 18:37776715-37776737 ACATAAGCTCAGATAAGGCAAGG - Intergenic
1157156789 18:45275804-45275826 ATGTAAGCTCAGTGAAGACAGGG - Intronic
1157356392 18:46938957-46938979 ATATAAGTTCAGTGAAGGCAGGG + Intronic
1159986943 18:74853891-74853913 ATGTCAGTTCTTAGAAGTCATGG + Intronic
1162857970 19:13483638-13483660 CTGGAAGTGCAGCTAAGTCATGG + Intronic
1163360688 19:16844251-16844273 ATGTTGGTTCAGATATTTCAGGG + Intronic
925810321 2:7693814-7693836 ATGTATCTGCAGATAAGCCAGGG - Intergenic
926257862 2:11224785-11224807 ATGTGGGGTCAGATCAGTCAGGG + Intronic
927611487 2:24545618-24545640 GTTTGAGATCAGATAAGTCAAGG + Intronic
929182445 2:39057046-39057068 ATGTAAGCTAAGAAAAGGCAAGG + Intronic
929558653 2:42941870-42941892 ATGCAAGTACAGAGAAGACAGGG - Intergenic
930697199 2:54423887-54423909 ATGAAAATTCAGACAAATCAGGG - Intergenic
931730744 2:65151368-65151390 ATTTAAATGCATATAAGTCAGGG + Intergenic
934561603 2:95316378-95316400 ATGCAAGTTCAGGCAAGCCAAGG - Intronic
934635131 2:95979379-95979401 ATATAACTGCTGATAAGTCATGG + Intronic
934834934 2:97577638-97577660 ATATAACTGCTGATAAGTCATGG + Intronic
935403967 2:102688978-102689000 ATGTAACTTAGGTTAAGTCACGG + Intronic
937627953 2:124064950-124064972 ATGTAAGTACAGAGGGGTCACGG - Intronic
938003014 2:127760961-127760983 AAGTATTTTCAGATAAGTCCAGG - Intronic
939584163 2:143986848-143986870 ATGTAAGTTCAGATGGTTAAAGG + Intronic
939916862 2:148055874-148055896 CTGTAAGTTTAGATAAGTCTTGG + Intronic
941982432 2:171473665-171473687 ATTTAAATTCAGAAATGTCATGG - Intronic
943019051 2:182551068-182551090 ATGTAAGTTCCTAAAGGTCAGGG - Intergenic
946586615 2:221196020-221196042 ATGTTAAATGAGATAAGTCAGGG + Intergenic
946800511 2:223411083-223411105 ACTGAAGTTTAGATAAGTCAAGG + Intergenic
1169308094 20:4511034-4511056 CTATAAGTTCAGAATAGTCATGG + Intergenic
1169877125 20:10310400-10310422 GTGTAAGTTCAGTTAATGCAAGG - Intergenic
1170020314 20:11830099-11830121 ATTTAATTTCAGTTAATTCAGGG - Intergenic
1175044096 20:56087814-56087836 ATGAAAGTTTAGAGAAATCAGGG - Intergenic
1177046493 21:16176667-16176689 ATGGAGGTTCAGTTAAGTTAGGG + Intergenic
1177425512 21:20917685-20917707 ATGTAACTACAGAAAAGACAGGG + Intergenic
956152628 3:66259440-66259462 AGGTAAGTTCAGACTAGGCAAGG - Intronic
956641127 3:71416607-71416629 ACGTATGGTCAGATAGGTCAGGG + Intronic
957977725 3:87469129-87469151 ATTTAACTTCTGAGAAGTCATGG - Intergenic
958060987 3:88480707-88480729 ATATAAGTTCCCATAAGGCAGGG + Intergenic
960616157 3:119597975-119597997 TTGGAAGTTCAGGTAAGCCAGGG + Exonic
961833573 3:129638411-129638433 ATGGAGGTTCAGAGAAGTTAGGG + Intergenic
961955964 3:130804537-130804559 ATGTAATTTCAAATATGTCTTGG + Intergenic
963965478 3:151364445-151364467 ATGTAAGTTCATTGAAGACAAGG + Intronic
964244615 3:154637162-154637184 ATGTAAATTCAAGTAATTCAGGG - Intergenic
964606693 3:158567841-158567863 ATGTAAGTTCCGAAAGGCCAGGG + Intergenic
964962633 3:162446857-162446879 ATGTAAGTTCAGTTAGACCACGG - Intergenic
966144613 3:176795769-176795791 ATGTAAATTCTGTAAAGTCAGGG + Intergenic
967382242 3:188872148-188872170 ATGTCAGTTCCTAGAAGTCAAGG + Intronic
970003899 4:11392448-11392470 CTGGAAGTTCAGAGAAGTTAAGG + Intergenic
971293416 4:25366747-25366769 ATGTAAGTTCACAGAATTAAAGG - Intronic
972184994 4:36517915-36517937 CTGTAAATTCAGATAAGCCTGGG + Intergenic
972695155 4:41438252-41438274 ATGGAGGTTCAGAGAAGTAAAGG + Intronic
974801191 4:66820701-66820723 ACTTAAGATCAGAGAAGTCAAGG - Intergenic
975922687 4:79411631-79411653 TTGTAAGTTCAATGAAGTCAGGG + Intergenic
976508429 4:85878662-85878684 ATGCAAGATCAGAAATGTCAAGG - Intronic
976900163 4:90164149-90164171 ATGTAGGTTCTCATAAGCCACGG - Intronic
977691472 4:99916508-99916530 ATGTAATTACTGATAAGTTAGGG + Intronic
978254683 4:106680331-106680353 ATGTAAGTGAAGATAAGACAGGG - Intergenic
978623975 4:110663898-110663920 ATTTAAGTTCTGGTAAGGCATGG + Intergenic
978691212 4:111513373-111513395 ATGTAATTTTAAATAAGCCAAGG - Intergenic
979777631 4:124610950-124610972 GTGTGTGTTCAGATAAGTAAAGG - Intergenic
980659995 4:135845007-135845029 AAGTAAGTTCAACTAAGTGAAGG + Intergenic
981425533 4:144598179-144598201 ATGAAAATTCAGAAAATTCATGG + Intergenic
982937986 4:161509324-161509346 AAGTAAGTACTGATATGTCAAGG + Intronic
982965452 4:161901145-161901167 ATGTAAATTCAGAAAGGGCAAGG - Intronic
984466805 4:180110195-180110217 ATGTAAGTTCAGATTCGCGAGGG - Intergenic
986453837 5:7894797-7894819 ATGTAAGTTCCGTAAAGACAGGG + Intronic
986604781 5:9510830-9510852 ATATAATTTCAGATAATTCAAGG + Intronic
987022183 5:13885953-13885975 ATGAAAGTTCAGGTAAGAGATGG - Exonic
988148985 5:27351151-27351173 TTGTAAGTTCTGTGAAGTCAGGG - Intergenic
989611880 5:43301715-43301737 ATGGCAGTCCAGATAAGACATGG + Intronic
990714702 5:58623902-58623924 ATGGAAGCACAGAGAAGTCAGGG - Intronic
990920755 5:60963680-60963702 ATGTAAGCTCAGTAAAGCCACGG - Intronic
992556800 5:77911894-77911916 TTGGAAGTTCAGATGGGTCAAGG - Intergenic
992727223 5:79620200-79620222 CTGTACGATCAGATGAGTCATGG + Intronic
992872325 5:81019365-81019387 CTGTGCGTTGAGATAAGTCACGG + Intronic
993910856 5:93682357-93682379 ATTTAACTTCAGATAACACAAGG + Intronic
994218021 5:97160373-97160395 ATTAAAGTTCAGAAAAGCCATGG - Intronic
994977301 5:106826249-106826271 AAGTATATTCACATAAGTCAGGG - Intergenic
994998251 5:107093236-107093258 ATGTAAATTCAGATCTATCATGG + Intergenic
997050799 5:130377428-130377450 CACTAACTTCAGATAAGTCATGG - Intergenic
997316966 5:132944577-132944599 GTGGAAGTTCAAATGAGTCAAGG + Intronic
999596195 5:153207332-153207354 ATGTAAGTTCAAGTAAGGTAGGG - Intergenic
1004913468 6:20308857-20308879 ATGTAAGTTCCGTAAAGGCAAGG + Intergenic
1005899786 6:30207348-30207370 ATGTAAGTTCTGGTAGGACAGGG - Intronic
1008207450 6:48680146-48680168 ATGTAAGTTCATATAAATTTTGG + Intergenic
1008320001 6:50099815-50099837 ATGGAAATTCAGATAAATCTTGG + Intergenic
1008332740 6:50262547-50262569 CTGTAAGTGCACAGAAGTCAAGG - Intergenic
1008884619 6:56418618-56418640 ATGTATCTTCAGATAATTCTTGG + Intergenic
1010543476 6:77121910-77121932 ATAAAAGCTCAGATAAGTAAGGG + Intergenic
1011321608 6:86100360-86100382 ATTTGAATTCAGATAAGTGATGG + Intergenic
1011542392 6:88445962-88445984 TTGTAAGTTAAAAAAAGTCAAGG - Intergenic
1011829359 6:91352475-91352497 ATTTAAGTTCAGATGATCCAGGG - Intergenic
1012767913 6:103393018-103393040 ATGTCATCTGAGATAAGTCAGGG + Intergenic
1014710563 6:124801697-124801719 ATGAAAGTTCAGACAAGGAAAGG + Intronic
1015265194 6:131284604-131284626 ATGTAAGTTCAGAGAAATTCAGG - Intergenic
1016193721 6:141304292-141304314 ATCTAACTTCAAATAAGTTACGG - Intergenic
1018800201 6:167216305-167216327 ATGTAAGTTCAGATAAGTCATGG + Intergenic
1018812898 6:167310201-167310223 ATGTAAGTTCAGATAAGTCATGG - Intronic
1021244424 7:18244468-18244490 CTGTAAGCTCAGAGAAGTCAAGG - Intronic
1021345549 7:19523510-19523532 ATTTAAGATTAGATAAGTAATGG + Intergenic
1021367511 7:19798500-19798522 ATTTAATTTCAGATAATTTAAGG - Intergenic
1028828331 7:95299912-95299934 ATGTATTTTCAGGTAAGCCAGGG + Intronic
1030177415 7:106669123-106669145 ATGTAAAGTCATCTAAGTCAGGG - Intergenic
1031151985 7:118064548-118064570 ATTTAAATTCACATAAATCATGG - Intergenic
1031389437 7:121195565-121195587 AGAAAAGTTTAGATAAGTCATGG + Intronic
1032137519 7:129293729-129293751 ATTTAAGTTCTTATAGGTCAGGG + Intronic
1036499333 8:9298867-9298889 AAGTAAGTTCAGATATAACAAGG + Intergenic
1037144002 8:15551156-15551178 ATGTAATTTCAGAGAACTAATGG - Intronic
1039150513 8:34499814-34499836 ATGGAAGATCAGACACGTCACGG + Intergenic
1039263753 8:35802317-35802339 AGGTGAGTTCAGAGAAGTGAAGG + Intergenic
1040724300 8:50363269-50363291 ATGTAAATTCAGGTAAGGCAGGG - Intronic
1041697818 8:60755756-60755778 ATGTATGTTCAGTCAACTCAAGG + Intronic
1041965997 8:63677359-63677381 AGGTAAGTTCAGATGAGTTCTGG - Intergenic
1042796739 8:72671939-72671961 ATGTGAGTTCAGCTAAGTCCAGG + Intronic
1043184662 8:77131812-77131834 ATGGAAGCTCAGAGAAGACAAGG + Intergenic
1043775965 8:84268842-84268864 ATATAAGTTCCCATAAGGCAAGG + Intronic
1045802048 8:106113148-106113170 ATCTAAGTTCAGGGAATTCATGG + Intergenic
1047135818 8:122077126-122077148 ATGAAACTTCAGAGAAGACATGG + Intergenic
1047476752 8:125239775-125239797 ATGTAAGTTCTGAAAAATCCAGG - Intronic
1050353255 9:4760295-4760317 CTGTAAGTTCAGCTTGGTCAAGG + Intergenic
1051260630 9:15261066-15261088 ATGGTAGTTTAGAGAAGTCAGGG - Intronic
1051521521 9:17994179-17994201 ATGACTGTTCAGATTAGTCAGGG - Intergenic
1055667633 9:78568583-78568605 ATGTAAGTTCTGCAGAGTCAGGG - Intergenic
1058609044 9:106755246-106755268 GTGTAAGTTCAAATCAGTCACGG - Intergenic
1190736721 X:53260373-53260395 AGGTAAGATCAGAGAGGTCATGG + Intronic
1194751298 X:97687302-97687324 ATAAAAGTACAGATAAGTCAAGG - Intergenic
1194927589 X:99844929-99844951 ATGCAAGTTCAGATATTCCAAGG - Intergenic
1196059571 X:111392892-111392914 AGGGAAGTTCAGATAGGTCTGGG + Intronic
1196348682 X:114700485-114700507 TTTTAAGTTCAGAAAAATCAGGG - Intronic
1198775835 X:140178150-140178172 AAATAAGTTCAGAGAAGTTAAGG - Intergenic
1202585545 Y:26421771-26421793 ATATAAATGCTGATAAGTCATGG - Intergenic