ID: 1018813151

View in Genome Browser
Species Human (GRCh38)
Location 6:167312281-167312303
Sequence TCCCGTTGGCTCCGTGGTGC CGG
Strand +
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 3 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1018813147_1018813151 -4 Left 1018813147 6:167312262-167312284 CCAGCGATGTTAACCTTGATCCC 0: 2
1: 0
2: 2
3: 15
4: 82
Right 1018813151 6:167312281-167312303 TCCCGTTGGCTCCGTGGTGCCGG No data
1018813145_1018813151 4 Left 1018813145 6:167312254-167312276 CCTCCTCACCAGCGATGTTAACC 0: 2
1: 0
2: 0
3: 5
4: 61
Right 1018813151 6:167312281-167312303 TCCCGTTGGCTCCGTGGTGCCGG No data
1018813146_1018813151 1 Left 1018813146 6:167312257-167312279 CCTCACCAGCGATGTTAACCTTG 0: 2
1: 0
2: 1
3: 2
4: 70
Right 1018813151 6:167312281-167312303 TCCCGTTGGCTCCGTGGTGCCGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1018813151 Original CRISPR TCCCGTTGGCTCCGTGGTGC CGG Intronic
No off target data available for this crispr