ID: 1018814362

View in Genome Browser
Species Human (GRCh38)
Location 6:167320037-167320059
Sequence GGCCGTCCACGCCTGGGCTT GGG
Strand +
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total
Summary

Found 3 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1018814357_1018814362 -9 Left 1018814357 6:167320023-167320045 CCTCCTGAGATGAGGGCCGTCCA No data
Right 1018814362 6:167320037-167320059 GGCCGTCCACGCCTGGGCTTGGG No data
1018814353_1018814362 5 Left 1018814353 6:167320009-167320031 CCAGGAGTGTGCACCCTCCTGAG No data
Right 1018814362 6:167320037-167320059 GGCCGTCCACGCCTGGGCTTGGG No data
1018814356_1018814362 -8 Left 1018814356 6:167320022-167320044 CCCTCCTGAGATGAGGGCCGTCC No data
Right 1018814362 6:167320037-167320059 GGCCGTCCACGCCTGGGCTTGGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1018814362 Original CRISPR GGCCGTCCACGCCTGGGCTT GGG Intergenic