ID: 1018816065

View in Genome Browser
Species Human (GRCh38)
Location 6:167332222-167332244
Sequence AACCCCGTGCTGTAACAAAC AGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 54
Summary {0: 1, 1: 0, 2: 1, 3: 5, 4: 47}

Found 3 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1018816065_1018816069 22 Left 1018816065 6:167332222-167332244 CCTGTTTGTTACAGCACGGGGTT 0: 1
1: 0
2: 1
3: 5
4: 47
Right 1018816069 6:167332267-167332289 AGCAGTTGGCTGCCTGTGGTCGG 0: 1
1: 6
2: 35
3: 122
4: 450
1018816065_1018816067 8 Left 1018816065 6:167332222-167332244 CCTGTTTGTTACAGCACGGGGTT 0: 1
1: 0
2: 1
3: 5
4: 47
Right 1018816067 6:167332253-167332275 TTGAACACAGTTTCAGCAGTTGG No data
1018816065_1018816068 18 Left 1018816065 6:167332222-167332244 CCTGTTTGTTACAGCACGGGGTT 0: 1
1: 0
2: 1
3: 5
4: 47
Right 1018816068 6:167332263-167332285 TTTCAGCAGTTGGCTGCCTGTGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1018816065 Original CRISPR AACCCCGTGCTGTAACAAAC AGG (reversed) Intronic
902209963 1:14897864-14897886 AACCGCTTGCTGAAACTAACCGG + Intronic
911688647 1:100806266-100806288 AACACTGTGCTTTAACCAACAGG + Intergenic
916657387 1:166888175-166888197 AACACAGTGCTGTTACAGACTGG + Intergenic
917528227 1:175808634-175808656 AACCTTTTGCTGTAATAAACTGG - Intergenic
920811706 1:209291986-209292008 AGCCCCGTGCTGTGGGAAACAGG + Intergenic
1067558744 10:47289756-47289778 AAACCTGTGCTGTCACACACTGG - Intergenic
1075596181 10:123731001-123731023 AACCCACTGCTTTCACAAACAGG + Intronic
1083774939 11:64889980-64890002 AACCCCGTTGTATAAGAAACAGG + Intergenic
1093097288 12:14985707-14985729 TACCCAGTGCTGAAACAAACAGG - Intergenic
1093108145 12:15114737-15114759 GACCCAGTGCTGTAAGAACCTGG - Intronic
1093656120 12:21695589-21695611 AACCCCGAGCTGGAATAAATGGG + Intronic
1104125131 12:125838871-125838893 AACCACGTGTTGTTACAAAAAGG + Intergenic
1107466125 13:40652261-40652283 AACCTACTGGTGTAACAAACTGG + Intronic
1108347234 13:49558326-49558348 AACCCTGAACTGGAACAAACGGG + Intronic
1109936334 13:69289701-69289723 ACCCCTTTGCTGTAACAAAATGG + Intergenic
1114336745 14:21698280-21698302 AACCCCGTGCTCTCTGAAACAGG + Intergenic
1123027356 14:105432993-105433015 AACCCCGTGCTGTAATATAGGGG + Intronic
1129976181 15:79823761-79823783 ATCCATCTGCTGTAACAAACTGG + Intergenic
1145014072 17:19385553-19385575 AACCCAGTCCTTTAACAAACTGG - Intronic
1149643398 17:58219888-58219910 AAGCCAGTGCAGTAACAAAGTGG - Intronic
1157082868 18:44546767-44546789 AACCCCCTGCTACAACAAAAAGG - Intergenic
1163865604 19:19770523-19770545 AACCCCGTGCTCTCTGAAACAGG + Intergenic
933344093 2:81061347-81061369 AACTCCTTTCTGTAAGAAACAGG + Intergenic
956892670 3:73627429-73627451 AACCCCTTGTTGTGACAACCAGG + Intergenic
959069836 3:101692028-101692050 AACCCCGTGCTCTCTGAAACAGG + Intergenic
959070739 3:101700182-101700204 AACCCCGTGCTCTCTGAAACAGG + Intergenic
963242473 3:143021251-143021273 AATACCTTACTGTAACAAACTGG + Intronic
970083326 4:12315622-12315644 ACCCCTTTCCTGTAACAAACAGG + Intergenic
974400679 4:61402236-61402258 AACCCCTTCCTGTACAAAACAGG - Intronic
974889372 4:67861316-67861338 AACCCCATGAGGTAACAAATGGG - Intronic
975830570 4:78363973-78363995 AACCTCGTGCTGTCCCACACTGG + Exonic
980998242 4:139802148-139802170 TACCCCATTCTGTAAGAAACTGG - Intronic
990160765 5:52937476-52937498 TACCCTGTGCTGTACCCAACTGG + Exonic
991085461 5:62644719-62644741 AGCCCCGTCCTGTAACATGCAGG + Intergenic
991342077 5:65622784-65622806 AATTCTGTGCTGTAAGAAACTGG + Intronic
1007792255 6:44317160-44317182 AACCCCGTGCTCTCTGAAACAGG + Intronic
1011481310 6:87796576-87796598 AATCCCCTGCTGTCACACACTGG + Intergenic
1018143024 6:160858718-160858740 AACACCGTGCTGTAACAACCAGG + Intergenic
1018816065 6:167332222-167332244 AACCCCGTGCTGTAACAAACAGG - Intronic
1020366287 7:7384206-7384228 AACCCAGTGCAGTAACATACTGG + Intronic
1022658798 7:32346735-32346757 AACACCATGCAGTAACAAAGAGG + Intergenic
1023550436 7:41364626-41364648 AACCCTGTGCTGGAACAGCCAGG + Intergenic
1029960421 7:104684580-104684602 AATCCCAGGCTGTATCAAACAGG + Intronic
1030622013 7:111800548-111800570 AATCCACTGGTGTAACAAACAGG + Intronic
1033294235 7:140115498-140115520 AACCCCGTGCTCTCTGAAACAGG + Intronic
1046497947 8:115038256-115038278 AACCCGGTGCTGTCACAAGCAGG - Intergenic
1186573137 X:10737444-10737466 AACCCCATGCTGAAACATGCCGG + Intronic
1196343125 X:114620307-114620329 AACCTCGTGCTGCATGAAACAGG - Intronic
1201440218 Y:14000682-14000704 AACCCCGTGCTCTCTGAAACAGG - Intergenic
1201444353 Y:14042026-14042048 AACCCCGTGCTCTCTGAAACAGG + Intergenic
1202174891 Y:22088645-22088667 AACTCAGCTCTGTAACAAACTGG + Intronic
1202216471 Y:22497737-22497759 AACTCAGCTCTGTAACAAACTGG - Intronic
1202326717 Y:23698332-23698354 AACTCAGCTCTGTAACAAACTGG + Intergenic
1202544053 Y:25971721-25971743 AACTCAGCTCTGTAACAAACCGG - Intergenic