ID: 1018816067

View in Genome Browser
Species Human (GRCh38)
Location 6:167332253-167332275
Sequence TTGAACACAGTTTCAGCAGT TGG
Strand +
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 2 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1018816065_1018816067 8 Left 1018816065 6:167332222-167332244 CCTGTTTGTTACAGCACGGGGTT 0: 1
1: 0
2: 1
3: 5
4: 47
Right 1018816067 6:167332253-167332275 TTGAACACAGTTTCAGCAGTTGG No data
1018816062_1018816067 11 Left 1018816062 6:167332219-167332241 CCTCCTGTTTGTTACAGCACGGG 0: 1
1: 0
2: 1
3: 4
4: 85
Right 1018816067 6:167332253-167332275 TTGAACACAGTTTCAGCAGTTGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1018816067 Original CRISPR TTGAACACAGTTTCAGCAGT TGG Intronic
No off target data available for this crispr