ID: 1018816069

View in Genome Browser
Species Human (GRCh38)
Location 6:167332267-167332289
Sequence AGCAGTTGGCTGCCTGTGGT CGG
Strand +
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 614
Summary {0: 1, 1: 6, 2: 35, 3: 122, 4: 450}

Found 3 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1018816066_1018816069 -3 Left 1018816066 6:167332247-167332269 CCTTTTTTGAACACAGTTTCAGC 0: 1
1: 1
2: 13
3: 309
4: 601
Right 1018816069 6:167332267-167332289 AGCAGTTGGCTGCCTGTGGTCGG 0: 1
1: 6
2: 35
3: 122
4: 450
1018816062_1018816069 25 Left 1018816062 6:167332219-167332241 CCTCCTGTTTGTTACAGCACGGG 0: 1
1: 0
2: 1
3: 4
4: 85
Right 1018816069 6:167332267-167332289 AGCAGTTGGCTGCCTGTGGTCGG 0: 1
1: 6
2: 35
3: 122
4: 450
1018816065_1018816069 22 Left 1018816065 6:167332222-167332244 CCTGTTTGTTACAGCACGGGGTT 0: 1
1: 0
2: 1
3: 5
4: 47
Right 1018816069 6:167332267-167332289 AGCAGTTGGCTGCCTGTGGTCGG 0: 1
1: 6
2: 35
3: 122
4: 450

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1018816069 Original CRISPR AGCAGTTGGCTGCCTGTGGT CGG Intronic
901055142 1:6445795-6445817 GGCAGTTGGGTGCCTGGGGGCGG - Exonic
901651607 1:10746389-10746411 AGCCGTTTACAGCCTGTGGTTGG - Intronic
901880875 1:12192982-12193004 TGGAGTTGGCTGCGTGTGTTGGG - Exonic
902142754 1:14370365-14370387 AGCAGCTTGCTGCCTGGGGGTGG - Intergenic
902219221 1:14954166-14954188 AACAGTTGGCTCCCTGGGGCAGG + Intronic
902479227 1:16702819-16702841 GGCAGTTGGGTGCCTGGGGGCGG + Intergenic
902756071 1:18550078-18550100 AGCAGATGGCTGCTGGGGGTTGG - Intergenic
903234164 1:21938676-21938698 TGCTGTTTGCTGCCTGCGGTTGG - Intergenic
903288113 1:22289740-22289762 AGCAGGGAGCTGCCTGTTGTGGG - Intergenic
903478987 1:23639501-23639523 AGCAGTGCACAGCCTGTGGTAGG + Intronic
904004197 1:27355219-27355241 AGTGCTTGGGTGCCTGTGGTTGG + Exonic
904132650 1:28286700-28286722 AGCAGGTGGATACCTGAGGTCGG - Intergenic
904617428 1:31757564-31757586 AGCAGGTGGCTGGCTGGGTTGGG - Intronic
907295256 1:53447615-53447637 AACAGTTGGCTGACTTTGATTGG - Intergenic
907701100 1:56788995-56789017 AGCAGCTGGCTGCCTCTGAAAGG + Exonic
907983430 1:59507219-59507241 AACAGTTGGCCGCCTGTGGGTGG + Intronic
908163167 1:61431745-61431767 ACCCGTTGTCTGCCTCTGGTGGG + Intronic
908444639 1:64189399-64189421 AACATTTGGCAGCATGTGGTTGG + Intergenic
908489293 1:64626975-64626997 AGCCATTCCCTGCCTGTGGTAGG + Intronic
908717946 1:67090031-67090053 ATGAGTTGGCTGCCTATGATTGG + Intergenic
908927947 1:69279258-69279280 AACAGTTGGCTGCCTTTGACTGG + Intergenic
908964413 1:69740660-69740682 AGCAGTTGGCTACATGTGATTGG + Intronic
909303439 1:74042450-74042472 ATCAGTTGGTGGCCTGTGATTGG + Intronic
909378099 1:74963268-74963290 AACAGTTGGCGGCCTGTGAGTGG + Intergenic
909858950 1:80579077-80579099 AGCAGTTTGCAGCCTGTGATTGG - Intergenic
910082919 1:83363369-83363391 AGCCTTTGGCAGCATGTGGTTGG - Intergenic
910352513 1:86314735-86314757 AACAGTTTGCTACCTGTGATTGG - Intergenic
910899639 1:92105892-92105914 ATAATTTGGCTGCCTGTGATTGG + Intronic
911422147 1:97656557-97656579 AGCAGATGGCTACATGAGGTTGG - Intronic
912118300 1:106435525-106435547 ATCAGTTGGCAGCCTGTGATTGG + Intergenic
912630823 1:111245396-111245418 ATCAGTTGGCTGCCTCTGATTGG + Intergenic
913011204 1:114685520-114685542 ACCAGTTGGCTGAATGTGGCTGG - Intronic
913347011 1:117819217-117819239 AACATTTGGCAGCATGTGGTTGG - Intergenic
916398581 1:164420127-164420149 ATCAGTTGGCAGCCTGGGATTGG - Intergenic
917077912 1:171225046-171225068 AGCAGTTTGCAGCCTGTGATTGG + Intergenic
918002538 1:180511214-180511236 ATCAGTTGGCTGCATGTATTTGG + Intergenic
918572305 1:186011289-186011311 AGCACTTGGCAGGCTGAGGTGGG - Intronic
919177982 1:194044059-194044081 ATCCGTTGGCTGCCTGTTATTGG - Intergenic
919709798 1:200714809-200714831 ATCAGTTGGCAACCTGTGATTGG - Intergenic
920084415 1:203404902-203404924 AGCAGGTGACAGCCTGGGGTTGG + Intergenic
920175829 1:204101228-204101250 ATGAGTTGGGTGCCTGAGGTGGG + Intronic
921098841 1:211911052-211911074 ACCACTTGGCTCCCTGTGGGTGG - Intergenic
921713097 1:218392476-218392498 AGCAGCTGTCAGCCTGAGGTAGG + Intronic
921798144 1:219371656-219371678 AGCAGTTGGCCACCTTTGATTGG - Intergenic
922613984 1:226950153-226950175 CTCTGTTGCCTGCCTGTGGTTGG + Intronic
922982179 1:229836429-229836451 AACAGTTGGCTGCCTGTGATTGG - Intergenic
924018162 1:239750639-239750661 AACAGTTGGCCGCCTTTGATTGG - Intronic
1063577760 10:7277123-7277145 AGCAGGTGGCTGCTCATGGTGGG - Intronic
1064834357 10:19509348-19509370 ATGAGTTGGCTGCCTGTGACTGG + Intronic
1064938912 10:20711354-20711376 AACAGTTGGCTCTCTGTGATTGG + Intergenic
1066293197 10:34032604-34032626 ATCAGTTGGCTGTCTATGATTGG - Intergenic
1067273476 10:44813241-44813263 ATCAGTTGGCTGCCTGTGATTGG - Intergenic
1068064809 10:52116095-52116117 GGCAGTTTGCAGCCTGTGATTGG + Intronic
1068083780 10:52349081-52349103 ATCAGTTGGCTGCCTGTAATTGG + Intergenic
1068200043 10:53772242-53772264 ATCACTTGGCTGCCTGTGATTGG - Intergenic
1068467376 10:57412164-57412186 ATCAACTGGCTGCCTGTGATTGG + Intergenic
1068555413 10:58453350-58453372 AACAGCTGGCTGCCTCTGGGAGG - Intergenic
1068693939 10:59945976-59945998 AACAGTTGGCAGCCTATGATTGG + Intergenic
1069755315 10:70771195-70771217 AGCAGTGGGAGGCCTGTGCTTGG - Intergenic
1069998559 10:72358903-72358925 AGAAGCGGGCTGCTTGTGGTAGG + Intergenic
1070023426 10:72608805-72608827 AACAGTTGGGTGCCTGTGGTTGG - Intronic
1070103350 10:73409858-73409880 AGCAGTTGGCTGTATGTATTTGG - Intronic
1071672690 10:87624325-87624347 AACACTTGGCTGCCTTTGATTGG - Intergenic
1072109790 10:92307626-92307648 AGCATTTGGGAGCCTGAGGTGGG + Intronic
1072279555 10:93853473-93853495 AACAGTGGGCTGCCTTTGATTGG - Intergenic
1072429761 10:95360504-95360526 ATCAGTTGGCAGCCTGGGATTGG - Intronic
1073678245 10:105673932-105673954 AGCAGTTTGCTGCCTTTGATTGG + Intergenic
1073714631 10:106090019-106090041 ATCAGTTGACAGCCTGTGATTGG + Intergenic
1074632892 10:115278550-115278572 ATCAGTTGGCAGCATGTGTTTGG + Intronic
1075165239 10:120062250-120062272 ACCACATGGCTGCCTGTGGGAGG + Intergenic
1075223109 10:120601375-120601397 AACAGTTGGCTGCCTGTGATTGG - Intergenic
1075240100 10:120770660-120770682 AACAGTTGGCTGCCTGTGAGTGG + Intergenic
1075566375 10:123507511-123507533 AACTGTTGGCTGCATGTTGTTGG + Intergenic
1075872987 10:125784110-125784132 AGCAGTTGGCCACCTCTGATTGG - Intergenic
1076515711 10:131043395-131043417 AGCAGCCGGCTGCCTGGGGTGGG - Intergenic
1077108978 11:853834-853856 GGAAGCAGGCTGCCTGTGGTGGG + Intronic
1077143381 11:1034603-1034625 AGCAGTTGGCTGCCTGCCCCTGG + Intronic
1078023859 11:7676086-7676108 AACAGTTGGCTGCCTATAATGGG - Intronic
1078908089 11:15706072-15706094 AACAGTCAGCTGCCTGCGGTTGG - Intergenic
1079136563 11:17778970-17778992 AGCAACTGGCTGGCTGTGGACGG + Intronic
1079462618 11:20696955-20696977 AACAGTTGGCTGCCTTTGGTTGG + Intronic
1081735992 11:45404652-45404674 AGCAGGAGGGTGTCTGTGGTGGG - Intergenic
1083207690 11:61162365-61162387 AACAGGTGGCTGCCTGTGATTGG - Intergenic
1083805858 11:65073567-65073589 AGCAGCTCGCAGCCTGCGGTGGG + Intronic
1084312936 11:68327095-68327117 AGCAGGTGGGGGCCTGCGGTGGG + Intronic
1084782512 11:71419695-71419717 AGCATTTGGGAGCCTGAGGTGGG - Intergenic
1085315141 11:75540275-75540297 TGGAGTCCGCTGCCTGTGGTGGG + Intergenic
1085619179 11:78024547-78024569 GTTAGTTGGCTGCTTGTGGTTGG + Intronic
1085733338 11:79018016-79018038 ACCATTTGGCTGCCTGCTGTGGG + Intronic
1087037586 11:93770716-93770738 AACAGTTGGCCGCCTGTGAGTGG - Intronic
1087742831 11:101909895-101909917 ATTAGTTGGCTGCCTATGATTGG - Intronic
1087822045 11:102723505-102723527 ATCAGGTGGCTGCATCTGGTTGG + Intronic
1088138107 11:106581620-106581642 AACAGTTGGCAGCCCTTGGTTGG + Intergenic
1088143329 11:106644967-106644989 AACAGTTGGCTGCCTGTGATTGG - Intergenic
1088489948 11:110377205-110377227 AACAGTTGGCCACCTGTGATTGG + Intergenic
1089985196 11:122805831-122805853 AAAAGTTCTCTGCCTGTGGTTGG - Intronic
1090402603 11:126458625-126458647 AGCAGGTGGCTGACTGTGCTGGG + Intronic
1090671593 11:128950270-128950292 ATCACTTGGCTGCCTGTGACTGG - Intergenic
1091072830 11:132584949-132584971 AACAGTTGGCTGCCTATGACTGG + Intronic
1092897301 12:13024800-13024822 AACAGTTGGCGACCTGTGATAGG + Intergenic
1092923613 12:13254527-13254549 AACAGTTGGCTGCCTGTGGTTGG + Intergenic
1093355862 12:18166101-18166123 AACAGTTGGCTGTCTGTGACTGG - Intronic
1093471621 12:19508047-19508069 ATCAGTTGGCTTGCTGTGCTTGG + Intronic
1095962612 12:47844894-47844916 AGCAGGTGGCTGCCCGGGGGCGG + Exonic
1097156559 12:57016290-57016312 AGCAGATGGCAGCCTCTGATAGG - Intronic
1097188158 12:57206656-57206678 AGCAGGTGGCAGGCTGCGGTAGG - Exonic
1097298239 12:57990419-57990441 AGCAGGTGGCAGCCTGTGATTGG + Intergenic
1098139156 12:67433921-67433943 ATCAGTTGGTAGCCTGTGATTGG - Intergenic
1098679545 12:73334297-73334319 AACAGTCGGCTGCCTGTGATTGG + Intergenic
1098780598 12:74681317-74681339 TTCAGTTTTCTGCCTGTGGTTGG - Intergenic
1099387971 12:82041101-82041123 AACAGTTGGCCACCTTTGGTTGG - Intergenic
1100540932 12:95556670-95556692 GGTAGTAGGCTGCCTGTGGGAGG + Intergenic
1101181492 12:102223402-102223424 AGCAGTTTAGTGCCTGTTGTAGG + Intergenic
1101310961 12:103578726-103578748 AGCAGTTGGCTCCCTTCGATTGG - Intergenic
1101538367 12:105641473-105641495 TGCAGCTGGCTGCCTATGGATGG + Intergenic
1101578590 12:106020935-106020957 GTCAGTTGGATGCCTGTGATTGG + Intergenic
1101674861 12:106908481-106908503 AACAGTTGGCCACCTGTGATTGG - Intergenic
1102746142 12:115250787-115250809 AGCAGTTTGCTTCCTCTGGATGG + Intergenic
1102925962 12:116826588-116826610 AGCAATTAGCTGCCGGGGGTGGG - Intronic
1103692780 12:122789280-122789302 GGGAGTTGGCTGACTGTGGTTGG + Intronic
1103945394 12:124523329-124523351 GGCAGGTGGCTGCCTGTTCTGGG + Intronic
1105250985 13:18698197-18698219 TGCAGTGGGCTGCCTGGGTTTGG - Intergenic
1105655485 13:22432849-22432871 ATTAGTTGGCTGCCTGTGATTGG - Intergenic
1105820288 13:24074933-24074955 AACAGTTGGCTGCCTGTGATTGG + Intronic
1106483495 13:30154225-30154247 TGCATCTGGCTGCCTGGGGTGGG - Intergenic
1106892497 13:34261159-34261181 GTCAGTTGGCAGCCTGTGATTGG + Intergenic
1107814192 13:44229525-44229547 AGCAGATGGCTGTCACTGGTGGG + Intergenic
1107988736 13:45798573-45798595 ACCAGTTGGCTGCATGTGATTGG - Intronic
1108005937 13:45946526-45946548 GCCAGTTAGCTGCCTGTGATTGG - Intergenic
1108187662 13:47904383-47904405 AGAGGTTGGCTGCCTGTGAGTGG - Intergenic
1108433809 13:50381695-50381717 AACAGTTAGCTGCCTTTGATTGG + Intronic
1109970453 13:69761329-69761351 AACAGTTGGCTGCCTGTGGTTGG + Intronic
1109996675 13:70136140-70136162 ATCAGTTGTTTGCCTGTGATTGG + Intergenic
1110439651 13:75513395-75513417 AACAGTTGGTTGCCTTTGATTGG - Intergenic
1111404268 13:87781940-87781962 AGCAATGGGCGGCCTGTGCTTGG - Intergenic
1111612062 13:90617306-90617328 AACATTTGGCAGCATGTGGTTGG - Intergenic
1112005538 13:95250558-95250580 AGCTGATGGCTTCCTGTGTTGGG - Intronic
1112225640 13:97537253-97537275 AACAGTTGGCTGCCTTTGGTTGG - Intergenic
1112244045 13:97712789-97712811 ATCAGCTGGCTGCCTGTGATTGG - Intergenic
1112244453 13:97718415-97718437 ATCAGTTGGATGCCTGTGATTGG - Intergenic
1113322459 13:109248522-109248544 AACAGCTGGCTGCCTGTGAGTGG + Intergenic
1113940486 13:114016156-114016178 AGCAGGTGACTGGCTTTGGTTGG + Intronic
1114142493 14:19930541-19930563 AGCAGTGGGCTCCTTGTGATTGG + Intergenic
1114502041 14:23177313-23177335 GACAGTTGGCTGCCTTTGATTGG - Intronic
1115531512 14:34332346-34332368 ATCAGTTGGCAGCCTGTGATTGG - Intronic
1115590021 14:34855274-34855296 AACAGTTTGCTGCCTGTGAGTGG - Intronic
1116036311 14:39631508-39631530 AACAGCTGGCTGCCTGTGATTGG - Intergenic
1116040556 14:39681229-39681251 ATCAGTTGGCAGCCTGTGACCGG + Intergenic
1116054115 14:39841261-39841283 ATCAGTTGGCTGCCTGTGACTGG - Intergenic
1116132452 14:40873848-40873870 GTCAGTTGGCAGCCTGTGATTGG - Intergenic
1116220290 14:42076620-42076642 AGCAGTTGGCTGCCTTAGATAGG + Intergenic
1116403404 14:44537784-44537806 ATCAGTTGGCAGTCTGTGATTGG + Intergenic
1117141630 14:52795810-52795832 AGCAGTTGGGAGGCTGAGGTGGG - Intergenic
1117969493 14:61237990-61238012 AAGAGTTGGCTGCCTGTGATTGG + Intronic
1119483612 14:74974722-74974744 AGCTGTTGGCTGCGGGAGGTGGG + Intergenic
1120357707 14:83455724-83455746 GACAGTTGGCTGCCTTTGATTGG - Intergenic
1120358350 14:83462274-83462296 AACAGTTGGCTGCCTTTAATTGG - Intergenic
1120682243 14:87494176-87494198 AGCAGTTTGCAGCATGTGATTGG - Intergenic
1121339173 14:93094770-93094792 AGCAGTGGGCTGGCTGTGGGAGG - Intronic
1121388172 14:93549772-93549794 AACAGTTGGCTGCCTTTGATTGG + Intronic
1122758566 14:104002562-104002584 AGCAGTTGGTTGCCTTTGATTGG + Intronic
1124116541 15:26848618-26848640 ATGAGTTGGCAGCCTGTGATTGG - Intronic
1124137142 15:27044812-27044834 ACCAGTTGGCCGCCTGTGACTGG + Intronic
1124715507 15:32057073-32057095 ATGAATTGGCTGCCTGTGATTGG + Intronic
1125023469 15:35007557-35007579 ATCACTTGGCTGCCTGTCATTGG - Intergenic
1125344811 15:38708529-38708551 AGCAGTTGGCTCCCTTTCCTAGG + Intergenic
1125820032 15:42621629-42621651 AACAGTTGGCTGTCTGTGATTGG + Intronic
1126674087 15:51144311-51144333 AGCAGTTGGCTGTAAGTGGATGG - Intergenic
1127557616 15:60102830-60102852 ATCAGATGACTGCCTTTGGTTGG - Intergenic
1127761314 15:62142183-62142205 AACAGTTGGCTGCCTTTCATTGG + Intergenic
1129765047 15:78159316-78159338 AGTGGTTGGCTGCCTAGGGTGGG - Intronic
1129803174 15:78432091-78432113 AGCAGTTGGCTGCCAGCCCTTGG - Intergenic
1130002647 15:80060171-80060193 AGCGGTTGGCTGGCGGGGGTCGG + Intronic
1130411401 15:83651734-83651756 AACAGTTGACCGCCTGTGATTGG - Intergenic
1130738793 15:86576486-86576508 AACAGTTGGCTGCCTTTGATTGG + Intronic
1131520764 15:93112834-93112856 AGAAGCTGGATGCCTGTGTTAGG - Intergenic
1131737293 15:95347375-95347397 AACAGTTGGCAGCCTGTGATTGG - Intergenic
1131844979 15:96481360-96481382 AACAGTAGGCTGTCTGTGATTGG + Intergenic
1131951749 15:97689058-97689080 AACAGTTGGCCACCTGTGATTGG + Intergenic
1132027620 15:98416620-98416642 AGGAGATGCCTGCCTGGGGTGGG - Intergenic
1132765207 16:1531029-1531051 AGCAGGAGGCTGGCTGTGGAAGG - Intronic
1133634214 16:7650726-7650748 AGCAGCTGGCTGCCTGTGTGAGG - Intronic
1133985835 16:10667391-10667413 AACAGTTGGCTGCCTGCGATTGG - Intronic
1134061539 16:11202422-11202444 AGCAGACGGCTGCCTTCGGTAGG - Intergenic
1134266304 16:12695672-12695694 AACAGTTGACTGCCTGTGATTGG - Intronic
1134423824 16:14119301-14119323 GGCAGTTGGCTGCCTCTGATTGG + Intronic
1134838372 16:17381149-17381171 ATCAGTTGTTTGCCTGTGGATGG + Intronic
1134909742 16:18014030-18014052 ATCGGTTGGCCGCCTGTGATTGG - Intergenic
1135081384 16:19439046-19439068 AACAATTGGTTGCCTGTGATTGG + Intronic
1135235774 16:20754443-20754465 CCCAGTTGGCTGCCTGTGACTGG - Intronic
1135461935 16:22651975-22651997 AACAGTTGGTTGCCTGTGATTGG + Intergenic
1136299224 16:29321965-29321987 GGGAGGTGGCTGCCTGTAGTGGG + Intergenic
1137048226 16:35687577-35687599 AGCATTAGACTGCCTGGGGTGGG + Intergenic
1137048519 16:35689455-35689477 ATCATTTGGCTGCCTGGGGTCGG + Intergenic
1137053114 16:35729766-35729788 ATCATTAGGCTGCCTATGGTCGG + Intergenic
1137449654 16:48559615-48559637 AACAATTGGCAGCCTGTGATTGG - Intronic
1137918758 16:52463929-52463951 AGCAGTGGGTTGCATATGGTAGG - Exonic
1138819052 16:60236279-60236301 AGCAGTTGGTTACCTGTGACTGG - Intergenic
1140513632 16:75526609-75526631 ATCAGTTGGCAGCCTGTGACTGG + Intergenic
1140699021 16:77564158-77564180 AGCAGTTTGGTGACTGAGGTGGG + Intergenic
1140702844 16:77598396-77598418 AGCAGCTGTCTGTCTGTGTTGGG - Intergenic
1141155823 16:81596352-81596374 AGAAATTAGCTGTCTGTGGTGGG + Intronic
1141385695 16:83620562-83620584 TCATGTTGGCTGCCTGTGGTTGG - Intronic
1142060919 16:88028520-88028542 GGGAGGTGGCTGCCTGTAGTGGG + Intronic
1143033763 17:3982684-3982706 AGCTGCTGGCGGCCTGTGGGTGG - Intergenic
1143410023 17:6703126-6703148 ATCACTTGACTCCCTGTGGTGGG + Exonic
1143707658 17:8710314-8710336 AACAGTGGGCCGCCTGTGATTGG - Intergenic
1144214248 17:13040941-13040963 AACAGTTGGCTGCCTGTGATTGG - Intergenic
1144233049 17:13228409-13228431 AACAGCTGGCTGCCTGTGATTGG + Intergenic
1144353099 17:14417734-14417756 ATCAGTTGGCAGTCTGTGATTGG + Intergenic
1144391090 17:14794010-14794032 AGCAGTTGGCCACATGTGATTGG - Intergenic
1145226466 17:21132620-21132642 AGCAGTTGGCTGCCTATGACTGG + Intronic
1146229750 17:31096547-31096569 TGCAGTGGGCTTCCTGTGATGGG + Intronic
1146285864 17:31573869-31573891 AGCAGCTGGCTGTCTTTTGTGGG + Intronic
1146741209 17:35285311-35285333 ATCACTTGGCAGCCTGTGATTGG + Intergenic
1146741329 17:35286334-35286356 ATCAGTTGGCAGCCTGTGATTGG + Intergenic
1147920763 17:43915546-43915568 AGCTGCTGGCTGGGTGTGGTCGG - Intergenic
1148382296 17:47208968-47208990 TGCAGTGGGCTGCCTCTGCTCGG + Intronic
1148472941 17:47906857-47906879 ATGAGTTGGCAGCCTGTGGAAGG + Intronic
1149216973 17:54369036-54369058 ATCAGTTGGCAGCCTGTGATTGG - Intergenic
1149791554 17:59482211-59482233 AGCACATGGCTGCCCATGGTAGG + Intergenic
1150933108 17:69606554-69606576 GACAGTTGGCTGCCTGTGATTGG - Intergenic
1151103300 17:71581024-71581046 AGCAGTTGGCTACCTTTGGTTGG - Intergenic
1151252942 17:72851696-72851718 ATCAGTTGGCTGCCTCTGGTTGG - Intronic
1151906752 17:77053971-77053993 AGCAGCTGGCTGCCTGGAGTGGG + Intergenic
1152937442 17:83148666-83148688 AGCATTTGTCTGTATGTGGTGGG - Intergenic
1153908298 18:9683662-9683684 AACAGTTGGCTGCCTTTGAGTGG + Intergenic
1153908961 18:9689673-9689695 AACAGTTGGCTGCCTGCGATTGG - Intergenic
1153964899 18:10170560-10170582 AACAGCTGGCTGCCTGTGAGTGG + Intergenic
1154267149 18:12889116-12889138 AGCTGGGGGCTGCCTCTGGTAGG + Intronic
1154437865 18:14360717-14360739 TGCAGTGGGCTGCCTGGGTTTGG + Intergenic
1154947118 18:21172934-21172956 AGCAGTTAGCTGGGTGTGGTGGG + Intergenic
1154994769 18:21629625-21629647 AACAGTTCGCTGTCTTTGGTTGG + Exonic
1155143844 18:23067434-23067456 AACGGTTGGCTGCCTGTGATTGG + Intergenic
1155736222 18:29225801-29225823 AGCAGTGGACTGCCAATGGTAGG - Intergenic
1155915250 18:31551134-31551156 AACAGTTGGCTGCCTGTGAGTGG - Intergenic
1156890271 18:42182927-42182949 AGCAGTTGGCCACCTTTGATTGG - Intergenic
1158865399 18:61633359-61633381 ATCAGTTGGCAGCCTGTGATTGG + Intergenic
1159165770 18:64697380-64697402 AACATTTGGCTGCCTGTGATTGG + Intergenic
1159336239 18:67071148-67071170 AACAGTTGGCGACCTGTGATTGG + Intergenic
1159655587 18:71027950-71027972 AACAGTTGGCTGCCTTTGATTGG + Intergenic
1159739516 18:72149200-72149222 ATCAGTTGGCAGCCTGTGATTGG - Intergenic
1159829747 18:73261357-73261379 AACAGTTGGCCACCTGTGATTGG - Intronic
1160138676 18:76298156-76298178 AACAATAGGCTGCCTGTGGTTGG + Intergenic
1160138691 18:76298237-76298259 AACAGTTGGCTGCCTGTGGTTGG + Intergenic
1160394486 18:78561855-78561877 AGCGGGTGGCTGCTTGTGGAAGG - Intergenic
1161058413 19:2201890-2201912 ACCAGTGGGCAGCCTGTGGGAGG - Intronic
1161167748 19:2797307-2797329 AGCTGTTGGCTGTCTCTGGGAGG + Intronic
1163091438 19:15022815-15022837 AGCAGATGGCTACCTGGCGTGGG - Intronic
1163783811 19:19264231-19264253 AGCAGAAGGCGGCCTCTGGTTGG - Intergenic
1164372199 19:27652535-27652557 ATCACTGGGCTGCCTGGGGTCGG + Intergenic
1164372649 19:27655595-27655617 ATCATTAGACTGCCTGTGGTTGG + Intergenic
1164372925 19:27657385-27657407 ATCATTAGACTGCCTGTGGTCGG + Intergenic
1164372937 19:27657455-27657477 ATCAATAGACTGCCTGTGGTCGG + Intergenic
1164372949 19:27657525-27657547 ATCATTAGACTGCCTGTGGTCGG + Intergenic
1164374346 19:27672375-27672397 ATTATTTGACTGCCTGTGGTCGG + Intergenic
1164374788 19:27675194-27675216 ATCCTTTGACTGCCTGTGGTCGG + Intergenic
1164376284 19:27691066-27691088 ATCATTAGACTGCCTGTGGTTGG + Intergenic
1164379641 19:27720739-27720761 AACATTAGACTGCCTGTGGTTGG + Intergenic
1164380523 19:27733812-27733834 ATCATTAGACTGCCTGTGGTTGG + Intergenic
1164576662 19:29409156-29409178 AACATGTGGCTGTCTGTGGTGGG - Intergenic
1164597510 19:29539883-29539905 TGCAGTGGGCTGTCTGTGCTGGG - Intronic
1164676254 19:30103778-30103800 AGCAGTTGGCAGCATTTGGAAGG - Intergenic
1165661291 19:37582594-37582616 AGCATTTGGAAGCCTGTGGGTGG - Intronic
1166147578 19:40848166-40848188 AGCAGTTGGCAGGTTGTGGTAGG + Intronic
1166151719 19:40880031-40880053 AGCAGTTGGCAGGTTGTGGTAGG + Intronic
1166170620 19:41025551-41025573 AGCAGTTGGCAGGTTGTGGTAGG + Intergenic
1166178446 19:41090594-41090616 AGCAGTTGGCAGGTTGTGGTAGG - Intronic
1166586883 19:43957056-43957078 AACAGTTGGCTCCCTTTGATTGG + Intronic
1167791042 19:51681726-51681748 ATCAGTTAGCTGCCTGTGATTGG - Intergenic
1202713266 1_KI270714v1_random:28725-28747 GGCAGTTGGGTGCCTGGGGGCGG + Intergenic
925563415 2:5223117-5223139 AGCAGTTACCTGCCAGTGGCAGG - Intergenic
925740010 2:6996860-6996882 AGCAGGTGGATGCCAGGGGTGGG + Intronic
926276734 2:11409232-11409254 AGCAGTAGCCTGACAGTGGTGGG + Intergenic
926466318 2:13193223-13193245 AGCAGTTGGCAGCCTGTGATTGG - Intergenic
926968092 2:18438118-18438140 ATGAGTTGGCTGCCTGTGATTGG + Intergenic
927204635 2:20599332-20599354 ACCCGTTGGCTGCCTGTGGCTGG - Intronic
927928042 2:27026635-27026657 AGCAGGTGGCTGGCTGGGGCGGG - Exonic
928261307 2:29769441-29769463 AGAAGTTGGCTCCCTGTGGTTGG + Intronic
928361628 2:30666658-30666680 ATCAGTTGGTAGCCTGTGATTGG - Intergenic
928382742 2:30834124-30834146 AGCAGTTGGCTACATTTGATTGG - Intergenic
928689050 2:33780051-33780073 AACAGTTGGCTACCTGTAATTGG - Intergenic
929327835 2:40639244-40639266 AGCAGTTGTTTGCCAGTGTTTGG - Intergenic
930474880 2:51869144-51869166 AGCAATTTGCAGCCTGTGATTGG + Intergenic
931232422 2:60386094-60386116 AGCAGGTGGCTGGGAGTGGTAGG - Intergenic
932306708 2:70708842-70708864 AATAGTTGGCTACCTGTGATTGG - Intronic
932659227 2:73638134-73638156 AATAGTTGGCTGCCTGTGAGTGG - Intergenic
932665779 2:73697804-73697826 AACAGTCGGCTGCCTGTGAGTGG - Intergenic
932827362 2:74954025-74954047 AGCAGCTGGCTGCCTGTAATTGG + Intergenic
933362623 2:81306990-81307012 ACCTGTTGGCTCGCTGTGGTAGG - Intergenic
933495477 2:83045431-83045453 ATCAGTTGGCTGCCTGTGATTGG - Intergenic
934170864 2:89540241-89540263 AGAGGTTGGCTGCTTGGGGTTGG + Intergenic
934281169 2:91614559-91614581 AGAGGTTGGCTGCTTGGGGTTGG + Intergenic
935850667 2:107215586-107215608 CACAGTTGGCTGCCTGTAGTTGG - Intergenic
935851169 2:107220722-107220744 AATAGTTGGCTACCTGTAGTTGG - Intergenic
936544232 2:113376800-113376822 AACAGTTGGCCACCTGTGATTGG + Intergenic
936550328 2:113432833-113432855 AAGAGTTGGCTGCCTGTGGTTGG + Intergenic
937809614 2:126184934-126184956 ATCAGTTGGCAGCCTGTGATGGG - Intergenic
938403595 2:131014716-131014738 AGCAGTGGTCTCCCTGAGGTGGG + Intronic
938708393 2:133953906-133953928 AGAATGTAGCTGCCTGTGGTGGG - Intergenic
939186827 2:138870919-138870941 AATAGTTGGCTGTCTGTGATTGG + Intergenic
939508857 2:143082069-143082091 AACAGTTGGCTACCTTTGATTGG - Intergenic
939609238 2:144290010-144290032 AACAGTTGGCTGTCTTTGATTGG - Intronic
941137731 2:161738502-161738524 AACAGTTGTCTGCCTGTGATTGG + Intronic
941311514 2:163938117-163938139 AATAGTTGGCTGCTTGTGATTGG + Intergenic
941491672 2:166149792-166149814 AGCAGATCTCTGCCTATGGTGGG + Intergenic
941923613 2:170874812-170874834 AGCAGTTGGGAGGCTGAGGTGGG + Intergenic
942139588 2:172964654-172964676 AGCAGCTGGCTGCCTGCAGCTGG - Intronic
943319992 2:186434190-186434212 AACATTTGGCAGCATGTGGTTGG + Intergenic
943594548 2:189840351-189840373 AACAACTGGCTGCCTGTGATTGG + Intronic
943627462 2:190216296-190216318 AGCAGTGGGTTGCCTATGGATGG + Intronic
943633202 2:190277705-190277727 ATCAGTTGGCTGCCTATGATTGG - Intronic
944308777 2:198208555-198208577 ATCACCTGGCTGCCTGTGATTGG + Intronic
944312586 2:198250575-198250597 ATCAGTTGGCTGTCTGGGATTGG + Intronic
945558739 2:211311732-211311754 AGGAGTTGACTGACTGAGGTAGG + Intergenic
946349723 2:219142279-219142301 TGAAGTTGGCTTCCTTTGGTAGG - Intronic
946789173 2:223283242-223283264 AACAGTTGGCTGCCTGTGATTGG + Intergenic
946843931 2:223842660-223842682 GGCAGGTGGATGCCTGAGGTCGG + Intergenic
947175204 2:227359332-227359354 AGCTGGTGCCTGCCTGAGGTAGG - Intergenic
947633840 2:231670306-231670328 AGCAGTTGTCTGACTGTGGGTGG + Intergenic
947820165 2:233063745-233063767 AGCAGGTGGCTGCCTGGTTTGGG + Intronic
947948408 2:234126417-234126439 AACAGTGGGCGGCCTGTGATGGG + Intergenic
948065902 2:235079518-235079540 GGCAGCTGGCAGCCTCTGGTAGG + Intergenic
948384059 2:237570847-237570869 AGCTGTTGTTTGCCTGTGGGGGG - Intergenic
1168850505 20:973381-973403 TGCAGTTGGCTGCCTGACTTTGG - Intronic
1169099370 20:2932750-2932772 AGTAGTTGGCAGCCTGAGATAGG + Intronic
1169302120 20:4452285-4452307 AGCTGTTGGCTGCCAGCTGTTGG + Intergenic
1170013241 20:11750682-11750704 ATCAGCTGGCTGCCTGTGATTGG - Intergenic
1170161245 20:13313397-13313419 AATAGTTGGCTGCCTGTGATTGG - Intergenic
1170163676 20:13341815-13341837 AGCTGTTGGCTGGCTGTTCTAGG + Intergenic
1170949595 20:20924735-20924757 AGCTGGGGGCTGCCTGTGGTGGG - Intergenic
1171055203 20:21899951-21899973 AACTGTTGGCTGCCTGTGATTGG + Intergenic
1171429223 20:25070149-25070171 AACAGTTGGCCCCCTGTGATTGG + Intergenic
1172843304 20:37915035-37915057 AGCTGTTTGCCGCCTGTCGTCGG + Intronic
1173417127 20:42866525-42866547 AGCAGCAGGGAGCCTGTGGTGGG - Intronic
1173902867 20:46603803-46603825 AGCAGTAGGCTGGATGTGGAGGG + Intronic
1174021614 20:47534801-47534823 AGCTGTTGGGTGGCTGAGGTGGG + Intronic
1174847061 20:53952679-53952701 ATCAATTGGTTGCCTGTGATTGG - Intronic
1175142318 20:56870167-56870189 AGCTGATGGCTGACTGTTGTTGG - Intergenic
1175640615 20:60626852-60626874 ATCAGTTGATTGCTTGTGGTCGG - Intergenic
1176457812 21:6928754-6928776 GGCAGTGGGCTGCCTGGGTTTGG - Intergenic
1176835984 21:13793838-13793860 GGCAGTGGGCTGCCTGGGTTTGG - Intergenic
1177612873 21:23475431-23475453 ATCAGTTGGCAGCCTGTGATTGG - Intergenic
1178541796 21:33457958-33457980 ATCAGTTGGCTGCTTGGGATTGG - Intronic
1178922864 21:36750412-36750434 AGCAGTGGGCTGGGTGTGGAGGG + Intergenic
1179226877 21:39461640-39461662 AACAGTTGGCCGCCTGTGATTGG + Intronic
1179465877 21:41572310-41572332 AGGAGTTGGCTGCCTATGATTGG + Intergenic
1179599086 21:42464020-42464042 AACAGTTGGCTGCATTTGATTGG + Intergenic
1180171837 21:46063497-46063519 ATCTGTTGGCAGCCTGTGATTGG + Intergenic
1180325671 22:11376241-11376263 AGCACTTAGCAGCCTATGGTAGG - Intergenic
1181364736 22:22367080-22367102 ACCAGCTGGCTGACTGTGGTTGG + Intergenic
1182032154 22:27167881-27167903 AGGAGTTGGCAGACTGTGGCTGG + Intergenic
1183107392 22:35624379-35624401 AACAGTTGGCTGCATTTGATTGG + Intronic
1183185112 22:36287190-36287212 AGGTGTTTCCTGCCTGTGGTGGG - Intronic
1183732929 22:39628542-39628564 AGCTGCTGGCTGGCTGAGGTTGG + Intronic
1183876279 22:40784893-40784915 AACAGTTGGCTGCCTGTGATTGG - Intronic
1184015462 22:41782695-41782717 TGCAGGTTGTTGCCTGTGGTTGG + Intronic
1184618813 22:45657829-45657851 AACAGTTGGCTGCCTTTGATTGG - Intergenic
1185294012 22:50044433-50044455 CCCAGCTGGCTGCCTGTGATTGG - Intronic
949090900 3:27813-27835 AGCAGTGGGGTGCCGGGGGTGGG - Intergenic
950141918 3:10621408-10621430 TGCATTTGGCTGCCTCTTGTCGG - Intronic
950314627 3:11989832-11989854 AACATTTAGCTGCCTGTGATTGG - Intergenic
950436345 3:12982766-12982788 AAGAGCTGCCTGCCTGTGGTGGG + Intronic
951131540 3:19051895-19051917 ATCAGTTAGCTGCTTATGGTTGG + Intergenic
951184238 3:19693576-19693598 AGCAGTTGGCTGTAAGTAGTTGG - Intergenic
951339911 3:21472698-21472720 ATCAGTTGGCAGCCTGTGATTGG - Intronic
951630520 3:24715152-24715174 AGTAGTTGGCTGTGTGTAGTAGG - Intergenic
951796604 3:26545866-26545888 ATCAGTTGGCTGCCTGTGATTGG - Intergenic
951934314 3:28004427-28004449 AACAGTTGACTGCCTGTGATTGG + Intergenic
952455615 3:33469019-33469041 AGCAGTTGGCTGCCTGTGATTGG + Intergenic
953422229 3:42763190-42763212 AATAGCTGGCTGCCTGTGATTGG + Intronic
954374998 3:50189389-50189411 AGAAGCTGCCAGCCTGTGGTAGG + Intergenic
954928305 3:54257164-54257186 AGCAGTTGGCTGCTTCAGATTGG - Intronic
955171549 3:56570462-56570484 AGCAGTTGGCCAACTGCGGTGGG + Intronic
955547900 3:60051365-60051387 ATCAGTTGGCAGCCTGTGATTGG - Intronic
956164432 3:66385697-66385719 AGCAGTTGGGAGACTGAGGTGGG - Intronic
956264842 3:67385339-67385361 AGGAGTGGGCTGCCTTTGGTCGG - Intronic
956535341 3:70269414-70269436 AACAGTTGACTGCCTTTGATTGG - Intergenic
958075651 3:88674182-88674204 AACAGTTGGCCACCTGTGATTGG + Intergenic
958201575 3:90324419-90324441 AGCACTTTGAGGCCTGTGGTGGG - Intergenic
958580295 3:96009584-96009606 AACAGTTGGCAGCTTGTGATTGG + Intergenic
960521954 3:118665163-118665185 AACAGTTGGCAGCCTGTGATTGG - Intergenic
960528839 3:118740948-118740970 ATCAGTTGGCATCCTGTGATTGG + Intergenic
961324828 3:126103877-126103899 AGCAGTGCCCTGCCTGTGGTGGG - Intronic
961379897 3:126490261-126490283 AGCAGCTGGCTGCCTCTCCTGGG - Intronic
961821853 3:129579235-129579257 AGCAGTGAGCTGCCTGAGGGCGG + Intronic
961982187 3:131091965-131091987 ATGATTTGGCTGCCTGTGATTGG + Intronic
963633169 3:147759478-147759500 AGAAGTTGGCTGCCTTTAGATGG + Intergenic
965301917 3:167015781-167015803 AGAAGTTTGCAGCCTGTGGTTGG + Intergenic
967328714 3:188268543-188268565 AACAGTTGGCTGTCTTTGATTGG + Intronic
968285349 3:197505381-197505403 GGCAGTGGGCTGCCTGCTGTCGG + Intergenic
970169857 4:13278728-13278750 AGCAGTTGGCTGGGAATGGTAGG - Intergenic
970709729 4:18847842-18847864 AACAGTTGGCTCCCTATGATTGG + Intergenic
971250148 4:24967782-24967804 AACATTTGGCAGCATGTGGTTGG + Intronic
971300488 4:25438126-25438148 AGCATGTGGCTGGCTGTTGTTGG - Intergenic
971795469 4:31221302-31221324 ATTAGTTGGCTGCCTGTGACTGG + Intergenic
972181033 4:36466008-36466030 AGCAGTTGCTTGGCTGTGGCAGG + Intergenic
973295960 4:48521043-48521065 AACAGCCGGCTGCCTGAGGTGGG - Exonic
973571256 4:52241968-52241990 AACAGTTGGCCACCTGTGATTGG + Intergenic
973821808 4:54668233-54668255 AGGAGGTGGCTGTTTGTGGTGGG + Intronic
974146523 4:57954358-57954380 GTCAGTTGGCAGCCTGTGATTGG + Intergenic
974314679 4:60263864-60263886 ATCAGTTAGCAGCCTGTGATTGG - Intergenic
974423661 4:61711761-61711783 AATCGTTGGCTGTCTGTGGTTGG + Intronic
974737143 4:65951349-65951371 ATCAGTTGGCAGTCTGTGATTGG - Intergenic
975074937 4:70194404-70194426 AACAGTTGGCTGCTTGTGATTGG + Intergenic
975672886 4:76799364-76799386 AACAGTTGGCCGCCTGTGAGTGG + Intergenic
976811667 4:89106367-89106389 AACAGTTGGCAGCATGCGGTTGG + Intronic
977706512 4:100076894-100076916 ACCAGGTGGCTGCCAGTGATTGG - Intergenic
977707948 4:100092419-100092441 ATCAGTTGGCTCCCTGTGATTGG + Intergenic
978294746 4:107191858-107191880 AGCAGTTGGCTACATTTGATTGG + Intronic
979170014 4:117590027-117590049 AACAGTTGGCTACCTTTGATTGG + Intergenic
979170632 4:117597317-117597339 AACAGTTGGCTGCATTTGATTGG + Intergenic
979182693 4:117751983-117752005 GTCAGTTGGCTGCCTGTAATTGG - Intergenic
979219425 4:118204532-118204554 AACAGTTGGCTGCCTCTGACTGG + Intronic
979809648 4:125020233-125020255 AACAGTTGGCTGCTTGTGGGTGG + Intergenic
980472815 4:133270392-133270414 AGCAGTCCGCTGGCTGTGATTGG - Intergenic
982007281 4:151075685-151075707 GGCATTTGGCAGCCTGAGGTAGG - Intergenic
982281476 4:153687655-153687677 ATCAGTTGGCTGCCTGTGATTGG - Intergenic
982492397 4:156045534-156045556 AACAGTTGGCTGCCTTTGATTGG - Intergenic
982806155 4:159766424-159766446 ATCAGTTGGCAGCCTGTGATTGG + Intergenic
983567624 4:169171133-169171155 AACAATTGGCTGCCTGCGATTGG - Intronic
983717190 4:170797487-170797509 ATTAGTTGGCTGCCTGGGATTGG - Intergenic
983969437 4:173852956-173852978 AGCAGTTGGCTGCCTGTGATTGG + Intergenic
984245964 4:177275517-177275539 AACACTTAGCTGTCTGTGGTTGG + Intergenic
984363918 4:178773812-178773834 ATTAGTTGGCTGTCTGTGATTGG + Intergenic
984617136 4:181911536-181911558 AGCAGCTGGCAGCCTGGGATTGG + Intergenic
985268285 4:188170603-188170625 ACTAGTTGGCTGCCTGTGATTGG - Intergenic
985393673 4:189517888-189517910 ATCACTTGACTGCCTGTGATGGG + Intergenic
985483914 5:138148-138170 AGCAATTAGCTGCCGGTGGGGGG - Intergenic
986251344 5:6061148-6061170 AGCCGTTGACAGCCTGAGGTGGG + Intergenic
986508585 5:8478787-8478809 AACAGTTGGTTGCCTGTGAGTGG - Intergenic
986671221 5:10144764-10144786 ATCAGGTGGCTGCATCTGGTTGG - Intergenic
986991090 5:13554026-13554048 AGCTGTTGGCAGCCTGGGCTGGG - Intergenic
987427629 5:17791848-17791870 GTCAGTTGGCTGCCTGTGATTGG - Intergenic
989098143 5:37800033-37800055 ATCAGTTGGCTGGCTGTGATTGG - Intergenic
989130478 5:38102126-38102148 AACAGTTGGCTGCCTCTGATTGG + Intergenic
989603473 5:43221720-43221742 AACAGTTGGCTGCCTTTGATTGG + Intronic
989776492 5:45214285-45214307 ATCAGTTGTCAGCCTGTGGTTGG - Intergenic
989945017 5:50213749-50213771 AGCAGTTTTCGGCCTATGGTGGG - Intergenic
990176400 5:53113093-53113115 AACAGTTGGCTGCCTTTGATGGG + Intergenic
991395542 5:66201052-66201074 AACAGTTGGCTGCCTTTGATTGG + Intergenic
993344951 5:86771150-86771172 ATCAGTTGGATGCCTGTGATTGG + Intergenic
993628335 5:90253033-90253055 AACAGTTGGCTGCCTGTGATTGG + Intergenic
994467571 5:100157879-100157901 AACAGTTGGCTGCATATGATTGG + Intergenic
994589935 5:101760010-101760032 AGCATTTGGCAGCATGTGGTTGG - Intergenic
995084574 5:108092560-108092582 AGCAGTTGGGAGACTGAGGTGGG - Intronic
995814915 5:116157363-116157385 GGCAGTTGGCTGGCTGGGCTTGG + Intronic
996424418 5:123298150-123298172 CCCTGTTGGCTGCCTGTGATTGG + Intergenic
996836735 5:127801951-127801973 ATCAGTTGGGTGCCTGTGATTGG + Intergenic
997133988 5:131305486-131305508 ATCAGTTGGCAGCTTGTGATTGG + Intronic
998162299 5:139820430-139820452 AGCAGTTGGTTGCTTGGGATTGG + Intronic
998731806 5:145086144-145086166 TGCAGTTGGCTGCCTGTGAGTGG + Intergenic
1000411163 5:160936057-160936079 AACATTTGGCTGCATGTGGTTGG - Intergenic
1001304065 5:170558669-170558691 AGCACTTGGCTGCCTCTTTTTGG - Intronic
1001882226 5:175254344-175254366 AGCACTTGGCTTTCTCTGGTTGG + Intergenic
1001920973 5:175599413-175599435 AACAGTTGGCTGCCTATGAGTGG - Intergenic
1002959788 6:1904251-1904273 AACAGTTGGCTGATTGTGGCAGG + Intronic
1003261716 6:4522721-4522743 AGCAGTCGGCCGCCTGTGAGTGG + Intergenic
1003326464 6:5095502-5095524 AACAGTTGGCTGCCTGTGATTGG + Intergenic
1003364726 6:5461539-5461561 AACAGGTGGCTGCCTGGGGCTGG - Intronic
1003845161 6:10166249-10166271 AACAGTTGGCCGCCTTTGATTGG + Intronic
1003983697 6:11414810-11414832 ATGAGTTGGCTGCCTGTGATTGG + Intergenic
1004052040 6:12093006-12093028 ATCAGTTGACTTCCTGTGATTGG + Intronic
1004277963 6:14254744-14254766 AGCATTTGGCCACCTGTGATTGG + Intergenic
1004321145 6:14632691-14632713 AGCAGCTGGAGGCCTGTGGAGGG - Intergenic
1004330198 6:14714244-14714266 AACAGTTGGCCCCCTGTGATTGG + Intergenic
1004362312 6:14982130-14982152 AACAGCTGGCTGCCTGTGATTGG - Intergenic
1005029009 6:21492104-21492126 ATGAGTTGGCTGCTTGTGATTGG - Intergenic
1006282169 6:33062224-33062246 ATCACTTGGCAGCCTGTGATTGG + Intergenic
1009405327 6:63305515-63305537 AACAGTTGGCTGCCTGTGATTGG - Intronic
1011198646 6:84809644-84809666 AGCTGCTGGCTGACTGCGGTAGG - Intergenic
1011595377 6:89010961-89010983 AACAGTTAGTTGCCTGTGATTGG - Intergenic
1012275937 6:97275716-97275738 AGCTCTTGGCTGAGTGTGGTGGG + Intronic
1013039684 6:106421286-106421308 AGCAGTTGGCTGGATGTGAATGG + Intergenic
1013755849 6:113460656-113460678 ATCAGTCGGCTGCCTGTGATTGG - Intergenic
1014600241 6:123402278-123402300 ATCAGTTGGCTGCCTGTGACTGG - Intronic
1014621882 6:123677180-123677202 AGCAAATGGCTGTCTTTGGTGGG - Intergenic
1014953030 6:127581855-127581877 ATCAGTTGGCAGCCTGTGATTGG + Intronic
1015275050 6:131375538-131375560 AGCAGTTTGCTGCCTGGAGCTGG + Intergenic
1015305124 6:131698355-131698377 AGCAGTTTCCTGCCTCTTGTGGG + Intronic
1015528265 6:134194291-134194313 ATCAGTTGGCATCCTGTGATTGG - Intronic
1016046938 6:139490692-139490714 AACAGTTGGCTGCCTGTGATTGG + Intergenic
1016207320 6:141484872-141484894 ATCAATTGGCAGCCTGTGATTGG - Intergenic
1016784834 6:147999360-147999382 ATGAGTTGGCTGTCTGTGATTGG + Intergenic
1016832042 6:148443912-148443934 ACCAGTTGGCTGTGTCTGGTTGG + Intronic
1016905241 6:149143268-149143290 ATCAGTTGGCTACCTGTGATTGG + Intergenic
1017918868 6:158854561-158854583 AGAGTTTAGCTGCCTGTGGTGGG + Intergenic
1017971017 6:159313126-159313148 AGCTGTTGGCTGGCTGTGATAGG + Intergenic
1018138644 6:160804872-160804894 AACAGTTGGCTACCTTTGATTGG + Intergenic
1018143020 6:160858673-160858695 AGCAGTTGGCTGCCTGTGATCGG - Intergenic
1018514808 6:164567841-164567863 AACAGTAGGCTGCCTGTGACTGG - Intergenic
1018816069 6:167332267-167332289 AGCAGTTGGCTGCCTGTGGTCGG + Intronic
1018918553 6:168154429-168154451 AACAGTTTGCTGCCTGTGATTGG + Intergenic
1019355838 7:578351-578373 ACCTGTCGCCTGCCTGTGGTGGG + Intronic
1020123566 7:5519613-5519635 AGCGCCTGGCTGACTGTGGTGGG + Intergenic
1020391541 7:7663061-7663083 CGCATTTGGGTGCCTGTGCTGGG - Intronic
1020828667 7:13065457-13065479 TACATTTGTCTGCCTGTGGTCGG + Intergenic
1020905257 7:14055959-14055981 AACAGTTGGCTGTCTTTGATAGG - Intergenic
1020942624 7:14560456-14560478 AGTAGTTGTCTTTCTGTGGTGGG + Intronic
1021168600 7:17370739-17370761 AACAGTTAGCTGGATGTGGTGGG + Intergenic
1021887010 7:25149030-25149052 AACAGTTGGCTGCCTTTGATTGG + Intronic
1022216395 7:28266581-28266603 ATCAGTTGGCAGCCTGTAATTGG + Intergenic
1022408852 7:30120422-30120444 AACAGTTGGCTGCCTGTGATTGG + Intronic
1022680455 7:32540550-32540572 CCCAGTTGGCTGCCTGTGATTGG + Intronic
1022862102 7:34377848-34377870 AACACTTGACTGCCTGTAGTTGG + Intergenic
1023243303 7:38173366-38173388 ATCAGTTGGCTGCCTGTGATTGG + Intergenic
1023520492 7:41045808-41045830 AGCTGATGGCTGCCTGGGGTTGG - Intergenic
1024654890 7:51443606-51443628 AACAGTTGGCTGCCTTCGATTGG + Intergenic
1024756578 7:52540320-52540342 ATCAGTTAGCAGCCTGTGATTGG + Intergenic
1025309026 7:57903553-57903575 AGCACTTTGCTGCCTATGGTAGG - Intergenic
1026562187 7:71459340-71459362 AACAGTTGGTTGCCTGTGGTTGG + Intronic
1026828112 7:73596467-73596489 CGCCGTTCACTGCCTGTGGTAGG + Exonic
1027299754 7:76819571-76819593 AGCCTTTGGCAGCATGTGGTTGG - Intergenic
1027477092 7:78646721-78646743 AGCAGTTGGCTGCTTGATGCAGG - Intronic
1027750004 7:82131265-82131287 ATCAGTGGGCAGCCTGTGATTGG - Intronic
1028482646 7:91324587-91324609 AACAGTTGGCTGCCTTTGAATGG + Intergenic
1028997394 7:97116580-97116602 ATCAGTTGGCAGCCTGTGATTGG + Exonic
1029867288 7:103647895-103647917 ATCAGTTGGCTGTCTGTAGATGG - Intronic
1030155346 7:106449033-106449055 AACAGTTGGCTGCCTGTGATTGG + Intergenic
1031281989 7:119816304-119816326 ACCAATTGGCAGCCTGTGATTGG + Intergenic
1031690311 7:124780224-124780246 AGCAGATTGCTGTCTGTGGGTGG + Intronic
1031793551 7:126141254-126141276 GGCAGTTTGCAGCCTGTGATTGG - Intergenic
1032312604 7:130802490-130802512 ATCAGTTGGCTCCCTGTGAATGG + Intergenic
1032820216 7:135517612-135517634 TGCAGTTGGGAGGCTGTGGTGGG - Intergenic
1033739235 7:144256588-144256610 AGCAGTTTCCTGCCTCTTGTGGG + Intergenic
1034341045 7:150355465-150355487 AACAGTTGGTTGCCTTTGATTGG + Intergenic
1034381076 7:150692795-150692817 AGCTGGTGGCAGCATGTGGTGGG + Exonic
1034837289 7:154364323-154364345 AGCTGTGCTCTGCCTGTGGTGGG - Intronic
1035429717 7:158809788-158809810 AACAGCTGGCTGCCTGTGATTGG - Intronic
1036138917 8:6188437-6188459 AAGAGTTGGCTGCCTGTGATTGG - Intergenic
1036445943 8:8822111-8822133 AGGAATTGGCTGCCCGTGGCCGG - Intronic
1036635337 8:10546641-10546663 AGCAGAGGGCTGCCTGTAGGTGG - Intronic
1037131203 8:15409789-15409811 AACAGTTAGCTGCCTGTGATTGG + Intergenic
1037690435 8:21177187-21177209 AGCAGTTGGCTGGGTGTGCAAGG - Intergenic
1037883050 8:22582111-22582133 AACAGGTGGCTCCCTGGGGTGGG + Intronic
1038367456 8:26950665-26950687 ATCAATTGGCAGCCTGTGATTGG - Intergenic
1039493303 8:37963937-37963959 AGCAGCAGGCTGGCTTTGGTAGG - Exonic
1040001604 8:42581623-42581645 AGCAGCTGGCTCCCTGAGGAGGG + Intergenic
1040273776 8:45987802-45987824 AGCACTTTGAGGCCTGTGGTGGG + Intergenic
1040802666 8:51360741-51360763 AAGAGTTGGCTGCCTTTGATTGG - Intronic
1040803202 8:51366276-51366298 AAGAGTTGGCTGCCTTTGATTGG - Intronic
1041061195 8:54036251-54036273 AGCACTTGGGTGGCTGAGGTGGG + Intergenic
1041655520 8:60345959-60345981 ACCAGTTGGCAGCCTGAGGCAGG + Intergenic
1042425911 8:68648403-68648425 AGCAGTTGTCTGCCAGTTATTGG - Intronic
1042545932 8:69951471-69951493 AACAGCTGGCAGCCTGTGATTGG - Intergenic
1042598379 8:70473282-70473304 ATCAGTTGGCTACCTGTGATTGG - Intergenic
1042781323 8:72494247-72494269 AACAGTTGGCCACCTGTGATTGG + Intergenic
1043024006 8:75044201-75044223 AGCAGTTTTCTGCCTTGGGTGGG - Intergenic
1043853715 8:85242190-85242212 AACAGTTGGCTGCCTTTGATTGG + Intronic
1044004002 8:86919498-86919520 ATCAGTTGACTCCCTGTGATTGG + Intronic
1044149402 8:88755645-88755667 AGCACTTGGGAGCCTGAGGTGGG + Intergenic
1044289468 8:90450965-90450987 AACAGCTGGCTGACTGTGATTGG + Intergenic
1044517831 8:93159906-93159928 AACAGTTGGCTGCCTGTGATTGG + Intronic
1044752849 8:95432675-95432697 AGCCATTTTCTGCCTGTGGTTGG + Intergenic
1045685209 8:104704377-104704399 ATCAGTTGGCTGCTTGTGATTGG - Intronic
1046336351 8:112793750-112793772 AATAGTTGGCTGCCTTTGATTGG + Intronic
1047088346 8:121544775-121544797 AGCAGTTTGCAGCCTATGATTGG - Intergenic
1047379058 8:124339307-124339329 AGCAGTTTGCAGCCTGTAATTGG - Intronic
1047379455 8:124345176-124345198 AGCAGTTTGCAGCCTGTCATTGG - Intronic
1048316016 8:133362788-133362810 AAGAGTTGGCTGTCTGTGATTGG - Intergenic
1048439948 8:134452555-134452577 AGGAGTGGGCTGCCTGCTGTGGG - Intergenic
1048680726 8:136838765-136838787 AACAGTTGGCTGCATTTGATCGG + Intergenic
1049501109 8:142966647-142966669 AACAGTTGGCTACATTTGGTTGG - Intergenic
1049902610 9:183987-184009 AAGAGTTGGCTGCCTGTGGTTGG - Intergenic
1049961907 9:745070-745092 AGCTGCTTGTTGCCTGTGGTGGG + Intronic
1050111073 9:2216822-2216844 ATGAGTTGGCTGCCTTTGATTGG - Intergenic
1051992578 9:23170794-23170816 ATCAGTTGGCTGCTTGTGATTGG + Intergenic
1053250686 9:36572023-36572045 AACAGTTGGCCACCTGTGATTGG - Intergenic
1053745634 9:41194273-41194295 AAGAGTTGGCTGCCTGTGGTTGG - Intronic
1054481636 9:65670941-65670963 AAGAGTTGCCTGCCTGTGGTTGG + Intronic
1054682708 9:68236998-68237020 AAGAGTTGGCTGCCTGTGGTTGG + Intronic
1054968602 9:71058805-71058827 ATAAATTGGCTGCCTGTGATTGG - Intronic
1055048500 9:71955570-71955592 AACAATTGGCTGACTATGGTTGG + Intronic
1055583249 9:77730311-77730333 AGCTTTTGCCTGCCTGCGGTAGG + Intronic
1055675418 9:78654445-78654467 ATCAGCTGGCTGCCTGTGACTGG - Intergenic
1055883591 9:81032389-81032411 ATCCGTTGGCAGCCTGTGATTGG - Intergenic
1056367894 9:85924018-85924040 AACAGTTGGCTGCCTGTGATTGG - Intergenic
1056491425 9:87111366-87111388 ATGAGTTGGCTGCCTGTATTAGG + Intergenic
1056523684 9:87423145-87423167 TACAGTTGGCTGTCTGTGATTGG - Intergenic
1057418089 9:94883464-94883486 AACAGTTGGCTGCCTGTCAATGG + Intronic
1057796413 9:98161154-98161176 GGCAAGTGGCTGCCTGTGCTTGG + Intronic
1057974778 9:99593812-99593834 GGCAGTCAGCTGACTGTGGTTGG - Intergenic
1059106500 9:111516253-111516275 ATCAGTTGGCAGCCTGTGATTGG - Intergenic
1059430095 9:114244791-114244813 ACCAGTTGGGTTTCTGTGGTGGG + Intronic
1060858200 9:126932960-126932982 TTCAGTTGGCGGCCTGTGTTAGG + Intronic
1061043888 9:128154078-128154100 ATCACTTGGCTGCCTGTGTCAGG + Intergenic
1061632137 9:131879089-131879111 AGAATTTTGCTTCCTGTGGTGGG + Intronic
1061809281 9:133153105-133153127 AGGAATTGGCTACATGTGGTTGG + Exonic
1061992919 9:134169979-134170001 ATCTGTGGGCTGCCTGGGGTGGG + Intergenic
1062026238 9:134342031-134342053 AGCTGGAGCCTGCCTGTGGTGGG + Intronic
1062495523 9:136829788-136829810 AGCAAGTGGCTGCTTGTGCTGGG + Intronic
1202781767 9_KI270718v1_random:5054-5076 AAGAGTTGGCTGCCTGTGGTTGG - Intergenic
1203384275 Un_KI270438v1:6498-6520 AGCAATTTGCGGTCTGTGGTGGG + Intergenic
1203375306 Un_KI270442v1:369344-369366 AGCACTTAGCAGCCTATGGTAGG - Intergenic
1185786191 X:2893018-2893040 AACAGTTGGCTCCCTGTGAGTGG + Intergenic
1185940455 X:4313028-4313050 AACAGTTGGCCGCCTTTGATTGG - Intergenic
1185984009 X:4810479-4810501 AACATTTGGCTGCCTTTGATTGG + Intergenic
1186858787 X:13651177-13651199 AGAAGTTGGCAGCTTGTGATTGG - Intergenic
1188878318 X:35460408-35460430 GGCAGTGGGCAGCCTGTGGATGG + Intergenic
1189419188 X:40841376-40841398 AACAGTTGGCTGCCTGTGATTGG + Intergenic
1189846187 X:45140988-45141010 AACAGTTGGCCACCTGTGATTGG - Intergenic
1193754567 X:85392020-85392042 AATAGTTGGCTGCATGTGATTGG - Intergenic
1194051413 X:89073772-89073794 AACAGTTGGCTACATATGGTTGG + Intergenic
1194141964 X:90219152-90219174 AGAAAATGGCAGCCTGTGGTGGG + Intergenic
1194241438 X:91454914-91454936 ATCAGTTGGTAGCCTGTGATTGG - Intergenic
1194569598 X:95538002-95538024 AGCAGTTAACTGCCTTTGATTGG + Intergenic
1194583362 X:95703863-95703885 ATCAGTTGGCAGCCTGTGATTGG - Intergenic
1194663337 X:96650237-96650259 AACAGTTGGCCGCCTTTGATTGG + Intergenic
1196424196 X:115553352-115553374 AACAGCTGGCTGCCTGTGAGTGG - Intergenic
1197496387 X:127187248-127187270 ATCAGTTGGCTGCCTGTGATTGG - Intergenic
1198627346 X:138591815-138591837 AGCAGTTGGCAGCCACTGGAGGG - Intergenic
1199255277 X:145712350-145712372 ATTAGTTGGTTGCCTGGGGTTGG - Intergenic
1201051050 Y:9935783-9935805 TGAAGTTGTCTGCCTGTGTTGGG - Intergenic
1201428817 Y:13884519-13884541 AGTAGTGGGCTGTGTGTGGTGGG + Intergenic