ID: 1018818726

View in Genome Browser
Species Human (GRCh38)
Location 6:167356240-167356262
Sequence CTCCTGAAGGGAGTCTCGGG TGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 108
Summary {0: 1, 1: 0, 2: 1, 3: 9, 4: 97}

Found 3 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1018818726_1018818734 -4 Left 1018818726 6:167356240-167356262 CCACCCGAGACTCCCTTCAGGAG 0: 1
1: 0
2: 1
3: 9
4: 97
Right 1018818734 6:167356259-167356281 GGAGCAGCACCTGGGTGGAATGG 0: 1
1: 0
2: 0
3: 33
4: 403
1018818726_1018818733 -9 Left 1018818726 6:167356240-167356262 CCACCCGAGACTCCCTTCAGGAG 0: 1
1: 0
2: 1
3: 9
4: 97
Right 1018818733 6:167356254-167356276 CTTCAGGAGCAGCACCTGGGTGG No data
1018818726_1018818736 16 Left 1018818726 6:167356240-167356262 CCACCCGAGACTCCCTTCAGGAG 0: 1
1: 0
2: 1
3: 9
4: 97
Right 1018818736 6:167356279-167356301 TGGACGAGATGACTCTGTCCTGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1018818726 Original CRISPR CTCCTGAAGGGAGTCTCGGG TGG (reversed) Intronic
900545731 1:3228129-3228151 CTTCTGAAGAGAGTCCCCGGAGG + Intronic
901020450 1:6252612-6252634 CTCCAGAATGGTGACTCGGGGGG - Intronic
901158111 1:7154257-7154279 CTACAGACGGGAGTCTCGGGTGG - Intronic
901717536 1:11168546-11168568 CCCCTGAAGAGGGTCTAGGGAGG - Intronic
903352376 1:22725501-22725523 ATACAAAAGGGAGTCTCGGGGGG - Intronic
910138270 1:83998638-83998660 CTCCAGATGGGAGACTCGGGCGG - Intronic
915572952 1:156755261-156755283 ATCCTGAAGCGAGTCTCTGGAGG + Intronic
919747286 1:201016797-201016819 GTCCTGAGGGCAGTCTCAGGAGG - Intronic
920542246 1:206787771-206787793 CTCAAGAAGGGAGGCTCTGGTGG + Intergenic
924434147 1:244023647-244023669 CTCAAGAAGGGAGGCTGGGGTGG + Intergenic
1069772964 10:70911070-70911092 CTCCTGAAGGGAGGCCTGAGAGG - Intergenic
1069856589 10:71444422-71444444 CTCCTGACAGGAGACTGGGGAGG + Intronic
1074506580 10:114076209-114076231 CTTGTGAAGTGAGTCTCAGGGGG + Intergenic
1076290420 10:129341349-129341371 CTCTGGAAGGGAGGCTGGGGAGG + Intergenic
1077082208 11:729161-729183 CTCTTGAGGGGGGTCTCAGGAGG - Intergenic
1077217252 11:1400169-1400191 CTCCTGCAGGGAGACTGGGCTGG - Intronic
1085698448 11:78725692-78725714 CTCCTGAAATGAGTCTCAGAGGG - Intronic
1089576962 11:119451638-119451660 CTGCCCAAGGGAGTCTCTGGAGG + Intergenic
1094536249 12:31324786-31324808 CTCCCGAGGGGAGGGTCGGGGGG - Intronic
1096511289 12:52130890-52130912 CTCCTGCTGTGAGTCTCAGGTGG + Intergenic
1096682857 12:53268463-53268485 CTCCTGGAGGGAGTGTCGGGAGG + Intronic
1104081055 12:125430915-125430937 GCCCTGAAGGGAGTGTGGGGAGG + Intronic
1105502965 13:20988631-20988653 CTTCTGCAGGGAGTCCCGGCGGG + Exonic
1105705751 13:22966543-22966565 GTCCTGCAGGGAGCCTCGCGGGG - Intergenic
1105858655 13:24391528-24391550 GTCCTGCAGGGAGCCTCGGGAGG - Intergenic
1106835837 13:33634601-33634623 ATCCTGAAAGGAGCCTCGAGAGG + Intergenic
1110425521 13:75362299-75362321 CTCCGGCAGGCAGTCTCCGGGGG + Exonic
1112041627 13:95553148-95553170 CTCCTGATGGCTGTCTCGCGGGG + Intronic
1112461496 13:99606927-99606949 CTCCCAAAGGGAGGCGCGGGCGG - Intronic
1113453673 13:110431951-110431973 GTCCTGCATGGAGTCTCGTGGGG + Intronic
1114348035 14:21817719-21817741 CTCCTGAAGGGCATCTTGGTTGG + Intergenic
1115733147 14:36293927-36293949 TTCCTGAAGGAAGTGTCAGGGGG - Intergenic
1116283374 14:42939486-42939508 CTCCAGAAGGGAATTTTGGGAGG + Intergenic
1116441582 14:44961273-44961295 ATCCTGCAGGGAGGCTAGGGCGG + Intronic
1118820905 14:69345301-69345323 CTCCCAAAGGGAGTCTGGAGAGG + Intronic
1119436368 14:74600288-74600310 CTCCTGAAGGGAGTTGCCAGTGG - Intronic
1119568812 14:75651736-75651758 CTCCTGTAGGAGGTCTAGGGTGG + Intronic
1122071833 14:99209964-99209986 CCCTTGATGAGAGTCTCGGGGGG - Intronic
1122893782 14:104745218-104745240 CACCTGCAGGGAGCCACGGGAGG + Intronic
1122995423 14:105261300-105261322 CTGCTGATGGGAGCCTCGCGTGG - Intronic
1125287081 15:38105303-38105325 CTCCTGTAGCGAGTCTCAGCAGG - Intergenic
1129255762 15:74333151-74333173 CTCCAGAAGGGAGTTTTGAGAGG - Intronic
1132640756 16:977327-977349 CTCCCGAAGGGGGTCTTGAGAGG + Intronic
1135322534 16:21506957-21506979 CTCCTGGAGGCAGTCCCCGGGGG - Intergenic
1136334013 16:29600095-29600117 CTCCTGGAGGCAGTCCCCGGGGG - Intergenic
1137696439 16:50465115-50465137 ATCCTGCAGGGACTCTCAGGAGG - Intergenic
1141566586 16:84906518-84906540 CTCCTGCAGGGACTCTGGGTGGG - Intronic
1142482904 17:229597-229619 CCCCTGAAGGGACACTCAGGGGG + Intronic
1147760740 17:42796026-42796048 CGGCAGAAGTGAGTCTCGGGAGG + Exonic
1148105176 17:45115025-45115047 CTCCTGAAGGGAGTCTGGAAAGG - Intronic
1148395527 17:47305049-47305071 GTCCTGAAAGGAGTTTGGGGTGG - Intronic
1155251417 18:23956800-23956822 CTTGTGAGGAGAGTCTCGGGAGG + Intergenic
1157149690 18:45204225-45204247 CTCCTGACGGGAGCCTCAAGAGG - Intergenic
1160122969 18:76146961-76146983 GTGCTGAAGGGAGCCTCTGGTGG + Intergenic
1161203312 19:3028107-3028129 CGCCTGATGGGAGTCTCTGTCGG - Intronic
1162536163 19:11263801-11263823 CTCCAGAGGGGAGTGTCGGCTGG - Intergenic
1168454717 19:56497356-56497378 CTCCTGAAGGGACTCTGGGCTGG - Intergenic
925942860 2:8837197-8837219 CTCCTGAGGGGCCCCTCGGGTGG - Intronic
939868776 2:147504842-147504864 CCCCTCAAGGGAGTATCGTGAGG - Intergenic
1171056246 20:21909638-21909660 CTCCTGGAGGGAGTAGCGGGGGG - Intergenic
1176555363 21:8252200-8252222 CTCGTGAGGGGGTTCTCGGGGGG + Intergenic
1179242155 21:39602033-39602055 CTTCTGACGGGAGTGTCGAGTGG + Intronic
1181403713 22:22667291-22667313 GTGCTCAGGGGAGTCTCGGGTGG + Intergenic
1181414003 22:22746404-22746426 GTACTCAGGGGAGTCTCGGGTGG + Intronic
1181474321 22:23159102-23159124 CTCCTGCAGGGAGGCCCAGGGGG - Intronic
1184045794 22:41971597-41971619 CTCCTCCAGGGAGTCTCGAGGGG - Intergenic
1184672446 22:46022037-46022059 CTCCTGACGGGGGTTTCTGGGGG - Intergenic
1185222459 22:49635931-49635953 CTTCTGGAGGGAGCCTGGGGAGG + Intronic
950362692 3:12461056-12461078 CTCATGAAGGGAGTGTTGCGGGG + Intergenic
950452490 3:13073161-13073183 CTCCTCCAGGGAGGCTGGGGCGG + Intergenic
950453328 3:13078063-13078085 CTCCTGCAGGGAGTGTCTGCAGG - Intergenic
954423989 3:50433884-50433906 CTCTTGGAGGGAGTGTCGAGGGG - Intronic
954579858 3:51697337-51697359 CTCCAGAAGGGAAGCTAGGGAGG + Intronic
954868773 3:53751194-53751216 CTCCTGAAGGGTATCTCATGTGG + Intronic
957357174 3:79105444-79105466 CTACTGATGGGAGTATCGAGTGG + Intronic
961099717 3:124188216-124188238 CTACTGAATAGAGTCTCTGGTGG - Intronic
968696650 4:2033634-2033656 CTCCTGAATGAAGTGTCTGGTGG + Intronic
969267542 4:6074310-6074332 CTCCTGCAGGGAGTCCAGGGAGG + Intronic
969615672 4:8251287-8251309 CCCATGAAGGGAATCTCTGGAGG + Intergenic
969875356 4:10132125-10132147 CTCCAGAATGGGGTCTTGGGGGG + Intergenic
969961224 4:10946629-10946651 CTCATGAAGGGAGTGCTGGGTGG + Intergenic
972584489 4:40424756-40424778 CTGCTGAAAAGAGTCTCTGGGGG + Exonic
975299670 4:72775026-72775048 CTCAGGAAGGGAGGCTAGGGAGG + Intergenic
977844911 4:101757285-101757307 CAGCTTAAGGGAGTCTCAGGAGG - Intronic
989812519 5:45695629-45695651 CGCCTGAAGGGAGGGTGGGGCGG + Intronic
990571280 5:57081492-57081514 CGCCTGTAGGGAGACTCAGGAGG - Intergenic
999238232 5:150112844-150112866 CTCCTGGAGGCAGTCCAGGGAGG + Intronic
1002140312 5:177133820-177133842 CCCCTGAAGAGAGACGCGGGGGG + Intronic
1002763419 6:218879-218901 CACCTGAAGGGAGCCTCAGCCGG + Intergenic
1007325386 6:41055510-41055532 CTCCAGGAGGGAGTCCTGGGGGG - Intronic
1013009543 6:106106952-106106974 CTCCAGAATGGAGTCGCAGGTGG - Exonic
1014221683 6:118804694-118804716 CAGCTGAAGGCAGTCTCTGGAGG - Intergenic
1018768449 6:166952330-166952352 CTCCTGGAGGCAGTCTCTGCAGG + Intronic
1018818726 6:167356240-167356262 CTCCTGAAGGGAGTCTCGGGTGG - Intronic
1018849329 6:167576093-167576115 CTGCTGAAGGGAGCATCTGGGGG - Intergenic
1019034070 6:169040251-169040273 CTCCTCATGGGAGTCCAGGGTGG - Intergenic
1019075512 6:169384407-169384429 CTGCTGAAGAGACTCTAGGGAGG - Intergenic
1019093930 6:169563787-169563809 CACCTGAAGGGGGACACGGGTGG + Intronic
1019170570 6:170131144-170131166 CTCCTGGAGGAAGTCTCAGCTGG - Intergenic
1026347868 7:69490558-69490580 CTTCTAAAGGGACTCTCCGGAGG + Intergenic
1030015521 7:105216424-105216446 CTCCTGAAAGGAGTTTTTGGGGG - Intronic
1034787984 7:153942742-153942764 CTCCTGAACAGAGTGTGGGGCGG - Intronic
1037903910 8:22704141-22704163 CTCCAGAAGGGAGAGTTGGGGGG - Intergenic
1043597958 8:81905750-81905772 GTCCTGAAGGGAGTACCTGGCGG + Intergenic
1056358144 9:85823632-85823654 CACCTGAAGTGAGTCTAGAGGGG - Intergenic
1057407784 9:94789233-94789255 TTCCTGAATAGAGTCTGGGGAGG + Intronic
1189093411 X:38112181-38112203 CTTCTAAAGAGAGTCTCAGGTGG - Intronic
1192181145 X:68916516-68916538 CTCATGAAGGGAGTCCTGGAAGG - Intergenic