ID: 1018823191

View in Genome Browser
Species Human (GRCh38)
Location 6:167389565-167389587
Sequence CTCAGTCATCTCTACAAGTT GGG
Strand +
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total
Summary

Found 3 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1018823187_1018823191 19 Left 1018823187 6:167389523-167389545 CCAGCTGGAAGTTGTGATGTCCT No data
Right 1018823191 6:167389565-167389587 CTCAGTCATCTCTACAAGTTGGG No data
1018823189_1018823191 -1 Left 1018823189 6:167389543-167389565 CCTCGAGTTTCTGGAAGCTTTTC No data
Right 1018823191 6:167389565-167389587 CTCAGTCATCTCTACAAGTTGGG No data
1018823186_1018823191 20 Left 1018823186 6:167389522-167389544 CCCAGCTGGAAGTTGTGATGTCC No data
Right 1018823191 6:167389565-167389587 CTCAGTCATCTCTACAAGTTGGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1018823191 Original CRISPR CTCAGTCATCTCTACAAGTT GGG Intergenic