ID: 1018823191

View in Genome Browser
Species Human (GRCh38)
Location 6:167389565-167389587
Sequence CTCAGTCATCTCTACAAGTT GGG
Strand +
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total 132
Summary {0: 2, 1: 0, 2: 0, 3: 8, 4: 122}

Found 3 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1018823186_1018823191 20 Left 1018823186 6:167389522-167389544 CCCAGCTGGAAGTTGTGATGTCC No data
Right 1018823191 6:167389565-167389587 CTCAGTCATCTCTACAAGTTGGG 0: 2
1: 0
2: 0
3: 8
4: 122
1018823187_1018823191 19 Left 1018823187 6:167389523-167389545 CCAGCTGGAAGTTGTGATGTCCT No data
Right 1018823191 6:167389565-167389587 CTCAGTCATCTCTACAAGTTGGG 0: 2
1: 0
2: 0
3: 8
4: 122
1018823189_1018823191 -1 Left 1018823189 6:167389543-167389565 CCTCGAGTTTCTGGAAGCTTTTC No data
Right 1018823191 6:167389565-167389587 CTCAGTCATCTCTACAAGTTGGG 0: 2
1: 0
2: 0
3: 8
4: 122

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1018823191 Original CRISPR CTCAGTCATCTCTACAAGTT GGG Intergenic
905607135 1:39311928-39311950 CTCACTCTTCTCTTCAGGTTTGG - Intronic
906585070 1:46968478-46968500 CTCAGCCATCTCTACATGTATGG - Intergenic
907840508 1:58152545-58152567 CTCAGTCTTCTCTGCAAAATGGG + Intronic
908265882 1:62378762-62378784 CTAACTCATCTCTAAAATTTGGG - Intergenic
909238358 1:73180994-73181016 CTCAGTCCTCTCCAGAATTTGGG - Intergenic
910524251 1:88159395-88159417 ATAAGACATTTCTACAAGTTTGG - Intergenic
911046316 1:93631651-93631673 CTCAGTCATCCCTACAGTTCGGG + Intronic
914746486 1:150505165-150505187 TTCATACATCTCTACAAGGTAGG - Intronic
916108289 1:161446457-161446479 ATCTGTCATCTCTACCTGTTGGG - Intergenic
916109875 1:161453837-161453859 ATCTGTCATCTCTACCTGTTGGG - Intergenic
916111462 1:161461248-161461270 ATCTGTCATCTCTACCTGTTGGG - Intergenic
916113048 1:161468628-161468650 ATCTGTCATCTCTACCTGTTGGG - Intergenic
916116481 1:161489069-161489091 ATCTGTCATCTCTACCTGTTGGG + Intergenic
918566793 1:185943514-185943536 CTGAGTCATATCTACAAGGAAGG - Intronic
920113898 1:203606335-203606357 CTGAGTAATTTCTACAAGCTAGG - Intergenic
920131966 1:203739144-203739166 CTCAATCATCTTTTTAAGTTTGG + Intronic
922340009 1:224647661-224647683 CTCTGTCCTCTCTAGAAGTGGGG - Intronic
922798304 1:228352385-228352407 GTCAGTAATCTCAACAATTTGGG + Intronic
923009000 1:230073509-230073531 CTTAGTCATGTCTACTAGTATGG + Intronic
1067277179 10:44846141-44846163 CTCCCTCATCTCTACAACTGGGG - Intergenic
1068752441 10:60610614-60610636 GACAGTGATCTCTTCAAGTTTGG - Intronic
1068794686 10:61066429-61066451 CTCAGTCAGGTGTACTAGTTAGG + Intergenic
1069702205 10:70435122-70435144 CTCGGTCATCTCTACATGCCTGG + Intronic
1072558781 10:96548982-96549004 CTTATTCATCTCTCCAAGATGGG + Intronic
1075936027 10:126342097-126342119 CACAGTCATCCCTGCAAGTGGGG - Intronic
1076349193 10:129803291-129803313 CTCTGTCAGTTCTACATGTTAGG + Intergenic
1080480649 11:32646250-32646272 CTCTGTCAGCTATACAAATTAGG + Intronic
1080538787 11:33246795-33246817 CTCAGTTAACTGTACAACTTGGG - Intergenic
1084113640 11:67029206-67029228 CTCAGTCATTCCTAAAAGCTGGG + Intronic
1085285787 11:75359705-75359727 CGCAGTCATCTCAGCAATTTGGG + Intergenic
1095655350 12:44662135-44662157 CTGAGTCATTTCCACAACTTTGG + Intronic
1098442668 12:70534784-70534806 CTCATTCATCTCCCCAAGCTCGG + Intronic
1101249539 12:102918202-102918224 CTCAGTCTTCTCTAAAAGTGTGG - Intronic
1102203791 12:111076363-111076385 CTAGGTCATCTCTACATGGTAGG - Intronic
1105573023 13:21622201-21622223 CTCAGTCAACTCTTCATTTTTGG - Intergenic
1109226491 13:59702271-59702293 CTCAGTCTTCATTATAAGTTAGG - Intronic
1110517340 13:76430028-76430050 CTCAGACATTTATACAAGTTTGG - Intergenic
1112066108 13:95794905-95794927 CTCAGACATGTCTACAAATATGG + Exonic
1114064317 14:19048030-19048052 CTCAGCCAGCACTAAAAGTTGGG + Intergenic
1114097942 14:19351968-19351990 CTCAGCCAGCACTAAAAGTTGGG - Intergenic
1117225248 14:53651737-53651759 TTCAGTCATCTCGGCAGGTTGGG + Intergenic
1120129538 14:80788741-80788763 CTCGGTCAACCCTACAATTTAGG + Intronic
1120356497 14:83441204-83441226 CTCAGGCTTCTCTGTAAGTTTGG - Intergenic
1120722278 14:87902115-87902137 CTCATTCATCACTACCATTTTGG + Intronic
1123775556 15:23575630-23575652 CTCACTCATCTCTGCAAGAATGG - Intronic
1124598015 15:31107133-31107155 TTCATTCTTCTTTACAAGTTTGG + Intronic
1130228942 15:82081904-82081926 CTCAGTCTTGTCTGCAAATTTGG + Intergenic
1131132844 15:89911076-89911098 CTCAGTCTTATCTACAAAATGGG + Intronic
1137760942 16:50939834-50939856 CTCAGTTTTCTCTACAAAATGGG + Intergenic
1139136863 16:64215323-64215345 CTCTGTGATCTGTACAAGATTGG + Intergenic
1140632784 16:76873755-76873777 CACAGTCATCTCCAGAAGTGTGG + Intergenic
1140863500 16:79039836-79039858 CTGACTCATCTCTACCAGTCAGG + Intronic
1150580877 17:66472882-66472904 CTCATTCACCTCCACAAATTAGG - Intronic
1153328085 18:3842318-3842340 CTAAGTCATGTTTAAAAGTTTGG + Intronic
1154396606 18:13996588-13996610 CTATGTCATCTCTGCAACTTTGG - Intergenic
1155456671 18:26023317-26023339 CATTTTCATCTCTACAAGTTTGG - Intronic
1161351026 19:3791769-3791791 CTCAGTGATCTCTAGGAATTTGG - Intronic
1165230327 19:34382725-34382747 CTAACTCATCTCTACATGCTGGG - Intronic
1166730202 19:45054955-45054977 CTCAGTGATCACTAGAATTTTGG - Intronic
931629122 2:64283661-64283683 CTCAGGCATCTCAAAAAGTCTGG - Intergenic
932216136 2:69967172-69967194 CTGATTCATCTCTCCAAGTGAGG - Intergenic
932839830 2:75071856-75071878 CTCAGTTCTCTCTTCCAGTTTGG - Intronic
933473654 2:82761352-82761374 ATCAGTCATCTGTACATGTGTGG - Intergenic
934819496 2:97359941-97359963 CCCAATCATCTCTAGAAATTGGG + Intergenic
946701301 2:222417022-222417044 CTCATTCACCACTAGAAGTTAGG - Intergenic
947776558 2:232716493-232716515 CTCAGTCATCCCTACTAGCTGGG + Intronic
1171415948 20:24980493-24980515 CTCGGTCACCTCTACACGCTGGG + Intronic
1173712800 20:45175444-45175466 CTCACTCATTTCTACATTTTTGG - Intronic
1174245032 20:49172822-49172844 CTCAGTGATTGCTACAAGTGAGG - Intronic
1174784026 20:53416044-53416066 CGCAGTCAGCTCTGCAATTTAGG + Intronic
1175479205 20:59299945-59299967 CTCAGCCATCTGCACAGGTTGGG - Intergenic
1178500524 21:33122182-33122204 CCCACTCATCTTTTCAAGTTAGG + Intergenic
1180188239 21:46150897-46150919 CTCAGTCACCCCGACAAGTGCGG - Intronic
1180482808 22:15770656-15770678 CTCAGCCAGCACTAAAAGTTGGG + Intergenic
1181020372 22:20098248-20098270 GTCTGTCATCTCAACAATTTGGG - Intronic
1182298080 22:29321695-29321717 CTCAGTCATTTATATCAGTTTGG - Intergenic
1182724663 22:32434626-32434648 CTCAGTAATCCCTAAAAGTGAGG - Intronic
1184963981 22:47953478-47953500 CTCACTCAACTCTACCATTTGGG + Intergenic
950117602 3:10461623-10461645 CTCATTCATCTCTGCAGGGTGGG - Intronic
953727234 3:45410671-45410693 CTCAGACATTTCTACAAGCTAGG + Intronic
953790260 3:45942064-45942086 CTCACTCATTTGTACCAGTTTGG + Intronic
955467545 3:59252681-59252703 TTCAGTCTTATCTACAATTTGGG + Intergenic
957624728 3:82642969-82642991 CTCTGTCCTCTCTACCAGATGGG + Intergenic
959350011 3:105250157-105250179 TTCAGTACTCTCAACAAGTTGGG - Intergenic
964599778 3:158486236-158486258 CTCAGTCAACACTAGAAGTCAGG - Intronic
968322969 3:197787827-197787849 CTCAGTCATCTCCATAAAGTAGG - Intergenic
979728790 4:123996609-123996631 CAGAGTCATGTCTGCAAGTTAGG - Intergenic
981543870 4:145874057-145874079 CTTAATGATCTCTAGAAGTTGGG - Intronic
981889284 4:149716362-149716384 CTCAGTCCTCACTCCAATTTTGG - Intergenic
986924197 5:12726686-12726708 CTAAGTGATAGCTACAAGTTGGG + Intergenic
990627214 5:57627618-57627640 CTGAGGCATCTATACAAGTGGGG + Intergenic
994278798 5:97874678-97874700 CTGACTCATCTGTACAACTTGGG - Intergenic
995051320 5:107708030-107708052 CTCAGTCATTTTTACAAATTAGG - Intergenic
999036904 5:148361669-148361691 TTAAATCATCTCTACAAGCTAGG - Intergenic
1006534315 6:34685737-34685759 TTCAGCCATCACTAAAAGTTGGG - Intronic
1009297423 6:61970531-61970553 CTCAGTAATCTCTAAATGCTAGG - Intronic
1009892429 6:69703506-69703528 GTCAGTCATCTCTACAGATTTGG - Intronic
1010054391 6:71547667-71547689 CTCAATCATCACAACAATTTTGG - Intergenic
1012185959 6:96217452-96217474 CTCACTTATCTTTACAATTTAGG - Intergenic
1012641718 6:101625769-101625791 CTCAGTCATCTTTATATATTTGG - Intronic
1016297793 6:142593950-142593972 CTCTGTCTTCTCAACAACTTTGG - Intergenic
1016806609 6:148218360-148218382 CTCTGTCATCTTTACATGTTAGG - Intergenic
1016885518 6:148956173-148956195 CTCAGTCATCCCTACCATATAGG + Intronic
1018793524 6:167168813-167168835 CTCAGTCATCTCTACAAGTTGGG - Intronic
1018823191 6:167389565-167389587 CTCAGTCATCTCTACAAGTTGGG + Intergenic
1027524114 7:79245490-79245512 GGCAGTACTCTCTACAAGTTCGG + Intronic
1028378605 7:90174230-90174252 ATCAGTAATCTCAACAATTTGGG + Intronic
1028676212 7:93464870-93464892 CTACGTCATCTCTACATATTGGG - Intronic
1031837127 7:126691410-126691432 CTCAGGCATCTCTGCACTTTTGG - Intronic
1037455291 8:19057489-19057511 TTCAATGATCTCTACTAGTTTGG + Intronic
1039889916 8:41678658-41678680 CACATTCATCTCTAGAAGATTGG + Intronic
1040685390 8:49865545-49865567 CTCAAGCATCTCTCCATGTTTGG + Intergenic
1041967586 8:63697915-63697937 CTCAGTCATAACTACATATTAGG + Intergenic
1044183660 8:89225640-89225662 CTCTGTGTTCACTACAAGTTGGG + Intergenic
1044525055 8:93242040-93242062 CCCAGGCATCTCTACAATCTTGG - Intergenic
1044760223 8:95510103-95510125 CTCAGTGAACTCTACAAATGTGG - Intergenic
1050124225 9:2339718-2339740 TTCAGTCATGTCTAGAAATTTGG - Intergenic
1053530023 9:38871277-38871299 CTGAGTATTATCTACAAGTTAGG + Intergenic
1054202248 9:62095704-62095726 CTGAGTATTATCTACAAGTTAGG + Intergenic
1054636110 9:67492656-67492678 CTGAGTATTATCTACAAGTTAGG - Intergenic
1185810507 X:3104839-3104861 CTCACTCATCTCTATAAGAAAGG + Intronic
1186051021 X:5595722-5595744 CTCTGTTCTCTTTACAAGTTTGG + Intergenic
1187358600 X:18602546-18602568 CTCACTAATCTCTTCCAGTTAGG - Intronic
1188144893 X:26599445-26599467 CTCAGTCATCTTTAATATTTTGG + Intergenic
1196424513 X:115556237-115556259 CTCAGTAATTTTTACAAGTGAGG - Intergenic
1196937144 X:120741231-120741253 GTCCCTCAGCTCTACAAGTTTGG + Intergenic
1198651488 X:138867987-138868009 CTGAGTCATCTCTCCTACTTTGG - Intronic
1199742685 X:150750549-150750571 CTCAGCCAGATCTATAAGTTTGG + Intronic
1199785056 X:151097923-151097945 CTCACTAATCTCTACAAGGAAGG - Intergenic
1201351834 Y:13052486-13052508 TTCAGTAATCCCTAAAAGTTCGG - Intergenic
1201908260 Y:19106918-19106940 GCCTGACATCTCTACAAGTTAGG + Intergenic
1202040261 Y:20675189-20675211 CTCAGTGATGTCTCCTAGTTAGG - Intergenic