ID: 1018826622 |
View in Genome Browser |
| Species | Human (GRCh38) |
| Location | 6:167412608-167412630 |
| Sequence | GCAACAAGGCAACGAGTAAC TGG |
| Strand | + |
| Crispr in exon? | No |
| Crispr in intron? | No |
| Off-Target Counts | All | Exonic | Intronic | Intergenic |
|---|---|---|---|---|
| Total | ||||
| Summary |
Found 1 Related Crispr Pairs
Show Crispr Pairs| ID | Spacer | Status | Summary | ID | Location | Sequence | Summary | |
|---|---|---|---|---|---|---|---|---|
| 1018826618_1018826622 | 30 | Left | 1018826618 | 6:167412555-167412577 | CCAAGAAAGCTGTAGGTAAAGAA | No data | ||
| Right | 1018826622 | 6:167412608-167412630 | GCAACAAGGCAACGAGTAACTGG | No data |
Note: the row highlighted in blue is the original CRISPR
| WGE ID | Location | Sequence | Mismatches | Strand | Type |
|---|---|---|---|---|---|
| 1018826622 | Original CRISPR | GCAACAAGGCAACGAGTAAC TGG | Intergenic | ||