ID: 1018826622

View in Genome Browser
Species Human (GRCh38)
Location 6:167412608-167412630
Sequence GCAACAAGGCAACGAGTAAC TGG
Strand +
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total
Summary

Found 1 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1018826618_1018826622 30 Left 1018826618 6:167412555-167412577 CCAAGAAAGCTGTAGGTAAAGAA No data
Right 1018826622 6:167412608-167412630 GCAACAAGGCAACGAGTAACTGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1018826622 Original CRISPR GCAACAAGGCAACGAGTAAC TGG Intergenic