ID: 1018832757

View in Genome Browser
Species Human (GRCh38)
Location 6:167457654-167457676
Sequence CCGGTTCCTCCTCTTTGCTA TGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 5 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1018832757_1018832762 4 Left 1018832757 6:167457654-167457676 CCATAGCAAAGAGGAGGAACCGG No data
Right 1018832762 6:167457681-167457703 TTTCTAGAGGAATTCCTGGCAGG No data
1018832757_1018832761 0 Left 1018832757 6:167457654-167457676 CCATAGCAAAGAGGAGGAACCGG No data
Right 1018832761 6:167457677-167457699 TGACTTTCTAGAGGAATTCCTGG No data
1018832757_1018832759 -9 Left 1018832757 6:167457654-167457676 CCATAGCAAAGAGGAGGAACCGG No data
Right 1018832759 6:167457668-167457690 AGGAACCGGTGACTTTCTAGAGG No data
1018832757_1018832766 30 Left 1018832757 6:167457654-167457676 CCATAGCAAAGAGGAGGAACCGG No data
Right 1018832766 6:167457707-167457729 CCCCCGCCCAGCAGGAGCTCTGG No data
1018832757_1018832764 22 Left 1018832757 6:167457654-167457676 CCATAGCAAAGAGGAGGAACCGG No data
Right 1018832764 6:167457699-167457721 GCAGGACACCCCCGCCCAGCAGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1018832757 Original CRISPR CCGGTTCCTCCTCTTTGCTA TGG (reversed) Intergenic
No off target data available for this crispr