ID: 1018833253

View in Genome Browser
Species Human (GRCh38)
Location 6:167462561-167462583
Sequence CTGTGTGCTGGGAAGGTGGG AGG
Strand +
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 6 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1018833244_1018833253 13 Left 1018833244 6:167462525-167462547 CCTTTTGACTTGACTGCCCATGT No data
Right 1018833253 6:167462561-167462583 CTGTGTGCTGGGAAGGTGGGAGG No data
1018833245_1018833253 -3 Left 1018833245 6:167462541-167462563 CCCATGTTCTCTGCTTGCTCCTG No data
Right 1018833253 6:167462561-167462583 CTGTGTGCTGGGAAGGTGGGAGG No data
1018833242_1018833253 22 Left 1018833242 6:167462516-167462538 CCATCCTTTCCTTTTGACTTGAC No data
Right 1018833253 6:167462561-167462583 CTGTGTGCTGGGAAGGTGGGAGG No data
1018833241_1018833253 30 Left 1018833241 6:167462508-167462530 CCTGTAGGCCATCCTTTCCTTTT No data
Right 1018833253 6:167462561-167462583 CTGTGTGCTGGGAAGGTGGGAGG No data
1018833246_1018833253 -4 Left 1018833246 6:167462542-167462564 CCATGTTCTCTGCTTGCTCCTGT No data
Right 1018833253 6:167462561-167462583 CTGTGTGCTGGGAAGGTGGGAGG No data
1018833243_1018833253 18 Left 1018833243 6:167462520-167462542 CCTTTCCTTTTGACTTGACTGCC No data
Right 1018833253 6:167462561-167462583 CTGTGTGCTGGGAAGGTGGGAGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1018833253 Original CRISPR CTGTGTGCTGGGAAGGTGGG AGG Intergenic
No off target data available for this crispr