ID: 1018833379

View in Genome Browser
Species Human (GRCh38)
Location 6:167463479-167463501
Sequence CCTAATGAGGAATTGGTCCC TGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total
Summary

Found 3 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1018833379_1018833384 -5 Left 1018833379 6:167463479-167463501 CCAGGGACCAATTCCTCATTAGG No data
Right 1018833384 6:167463497-167463519 TTAGGATATGTACTGAGCATGGG No data
1018833379_1018833383 -6 Left 1018833379 6:167463479-167463501 CCAGGGACCAATTCCTCATTAGG No data
Right 1018833383 6:167463496-167463518 ATTAGGATATGTACTGAGCATGG No data
1018833379_1018833385 3 Left 1018833379 6:167463479-167463501 CCAGGGACCAATTCCTCATTAGG No data
Right 1018833385 6:167463505-167463527 TGTACTGAGCATGGGCTGTAAGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1018833379 Original CRISPR CCTAATGAGGAATTGGTCCC TGG (reversed) Intergenic