ID: 1018833380

View in Genome Browser
Species Human (GRCh38)
Location 6:167463479-167463501
Sequence CCAGGGACCAATTCCTCATT AGG
Strand +
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total
Summary

Found 2 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1018833376_1018833380 6 Left 1018833376 6:167463450-167463472 CCAACTCAAGGGCGTGGAGACAA No data
Right 1018833380 6:167463479-167463501 CCAGGGACCAATTCCTCATTAGG No data
1018833374_1018833380 13 Left 1018833374 6:167463443-167463465 CCATTGTCCAACTCAAGGGCGTG No data
Right 1018833380 6:167463479-167463501 CCAGGGACCAATTCCTCATTAGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1018833380 Original CRISPR CCAGGGACCAATTCCTCATT AGG Intergenic