ID: 1018834032

View in Genome Browser
Species Human (GRCh38)
Location 6:167470174-167470196
Sequence TAGGATCCTGAGTCAGAGCA GGG
Strand +
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 4 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1018834030_1018834032 -10 Left 1018834030 6:167470161-167470183 CCAGTGTCTGCTGTAGGATCCTG No data
Right 1018834032 6:167470174-167470196 TAGGATCCTGAGTCAGAGCAGGG No data
1018834027_1018834032 11 Left 1018834027 6:167470140-167470162 CCATGGATTTGCCAGACATGGCC No data
Right 1018834032 6:167470174-167470196 TAGGATCCTGAGTCAGAGCAGGG No data
1018834026_1018834032 12 Left 1018834026 6:167470139-167470161 CCCATGGATTTGCCAGACATGGC No data
Right 1018834032 6:167470174-167470196 TAGGATCCTGAGTCAGAGCAGGG No data
1018834028_1018834032 0 Left 1018834028 6:167470151-167470173 CCAGACATGGCCAGTGTCTGCTG No data
Right 1018834032 6:167470174-167470196 TAGGATCCTGAGTCAGAGCAGGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1018834032 Original CRISPR TAGGATCCTGAGTCAGAGCA GGG Intergenic
No off target data available for this crispr