ID: 1018834627

View in Genome Browser
Species Human (GRCh38)
Location 6:167473637-167473659
Sequence GCCCAGCTGCCACCTGGGAC AGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total
Summary

Found 1 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1018834627_1018834631 -9 Left 1018834627 6:167473637-167473659 CCTGTCCCAGGTGGCAGCTGGGC No data
Right 1018834631 6:167473651-167473673 CAGCTGGGCCACGGTAGAGCTGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1018834627 Original CRISPR GCCCAGCTGCCACCTGGGAC AGG (reversed) Intergenic