ID: 1018838355

View in Genome Browser
Species Human (GRCh38)
Location 6:167501649-167501671
Sequence TCACTATGTTGAGGGAGAGA AGG
Strand +
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 5 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1018838351_1018838355 13 Left 1018838351 6:167501613-167501635 CCATGCATTGAGTTAGATGTGCT No data
Right 1018838355 6:167501649-167501671 TCACTATGTTGAGGGAGAGAAGG No data
1018838348_1018838355 29 Left 1018838348 6:167501597-167501619 CCATGTGGGAACCAACCCATGCA No data
Right 1018838355 6:167501649-167501671 TCACTATGTTGAGGGAGAGAAGG No data
1018838349_1018838355 18 Left 1018838349 6:167501608-167501630 CCAACCCATGCATTGAGTTAGAT No data
Right 1018838355 6:167501649-167501671 TCACTATGTTGAGGGAGAGAAGG No data
1018838347_1018838355 30 Left 1018838347 6:167501596-167501618 CCCATGTGGGAACCAACCCATGC No data
Right 1018838355 6:167501649-167501671 TCACTATGTTGAGGGAGAGAAGG No data
1018838350_1018838355 14 Left 1018838350 6:167501612-167501634 CCCATGCATTGAGTTAGATGTGC No data
Right 1018838355 6:167501649-167501671 TCACTATGTTGAGGGAGAGAAGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1018838355 Original CRISPR TCACTATGTTGAGGGAGAGA AGG Intergenic
No off target data available for this crispr