ID: 1018841623

View in Genome Browser
Species Human (GRCh38)
Location 6:167521594-167521616
Sequence TTTCCTGAGCCTGTGATCTC TGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 3 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1018841623_1018841627 7 Left 1018841623 6:167521594-167521616 CCAGAGATCACAGGCTCAGGAAA No data
Right 1018841627 6:167521624-167521646 AAAGAAGAAGGAAATGCCGAGGG No data
1018841623_1018841624 -5 Left 1018841623 6:167521594-167521616 CCAGAGATCACAGGCTCAGGAAA No data
Right 1018841624 6:167521612-167521634 GGAAACACCAACAAAGAAGAAGG No data
1018841623_1018841626 6 Left 1018841623 6:167521594-167521616 CCAGAGATCACAGGCTCAGGAAA No data
Right 1018841626 6:167521623-167521645 CAAAGAAGAAGGAAATGCCGAGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1018841623 Original CRISPR TTTCCTGAGCCTGTGATCTC TGG (reversed) Intergenic
No off target data available for this crispr