ID: 1018841976

View in Genome Browser
Species Human (GRCh38)
Location 6:167523986-167524008
Sequence GCATCCTCCTGAACCGGAAG AGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 7 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1018841976_1018841981 10 Left 1018841976 6:167523986-167524008 CCTCTTCCGGTTCAGGAGGATGC No data
Right 1018841981 6:167524019-167524041 GCGTCATGGAGTGTGAGGTTGGG No data
1018841976_1018841983 15 Left 1018841976 6:167523986-167524008 CCTCTTCCGGTTCAGGAGGATGC No data
Right 1018841983 6:167524024-167524046 ATGGAGTGTGAGGTTGGGAAGGG No data
1018841976_1018841982 14 Left 1018841976 6:167523986-167524008 CCTCTTCCGGTTCAGGAGGATGC No data
Right 1018841982 6:167524023-167524045 CATGGAGTGTGAGGTTGGGAAGG No data
1018841976_1018841978 -4 Left 1018841976 6:167523986-167524008 CCTCTTCCGGTTCAGGAGGATGC No data
Right 1018841978 6:167524005-167524027 ATGCAGTTAACACAGCGTCATGG No data
1018841976_1018841984 22 Left 1018841976 6:167523986-167524008 CCTCTTCCGGTTCAGGAGGATGC No data
Right 1018841984 6:167524031-167524053 GTGAGGTTGGGAAGGGTCCTTGG No data
1018841976_1018841979 5 Left 1018841976 6:167523986-167524008 CCTCTTCCGGTTCAGGAGGATGC No data
Right 1018841979 6:167524014-167524036 ACACAGCGTCATGGAGTGTGAGG No data
1018841976_1018841980 9 Left 1018841976 6:167523986-167524008 CCTCTTCCGGTTCAGGAGGATGC No data
Right 1018841980 6:167524018-167524040 AGCGTCATGGAGTGTGAGGTTGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1018841976 Original CRISPR GCATCCTCCTGAACCGGAAG AGG (reversed) Intergenic
No off target data available for this crispr