ID: 1018842044

View in Genome Browser
Species Human (GRCh38)
Location 6:167524350-167524372
Sequence CAGGCTCTTCATCCTGTCGT TGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 8 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1018842044_1018842048 1 Left 1018842044 6:167524350-167524372 CCAACGACAGGATGAAGAGCCTG No data
Right 1018842048 6:167524374-167524396 GGCTCCGTAAGCAGCCTGGTTGG No data
1018842044_1018842055 22 Left 1018842044 6:167524350-167524372 CCAACGACAGGATGAAGAGCCTG No data
Right 1018842055 6:167524395-167524417 GGGAGGCGACACTGCTGGTTGGG No data
1018842044_1018842049 2 Left 1018842044 6:167524350-167524372 CCAACGACAGGATGAAGAGCCTG No data
Right 1018842049 6:167524375-167524397 GCTCCGTAAGCAGCCTGGTTGGG No data
1018842044_1018842051 5 Left 1018842044 6:167524350-167524372 CCAACGACAGGATGAAGAGCCTG No data
Right 1018842051 6:167524378-167524400 CCGTAAGCAGCCTGGTTGGGAGG No data
1018842044_1018842054 21 Left 1018842044 6:167524350-167524372 CCAACGACAGGATGAAGAGCCTG No data
Right 1018842054 6:167524394-167524416 TGGGAGGCGACACTGCTGGTTGG No data
1018842044_1018842056 25 Left 1018842044 6:167524350-167524372 CCAACGACAGGATGAAGAGCCTG No data
Right 1018842056 6:167524398-167524420 AGGCGACACTGCTGGTTGGGAGG No data
1018842044_1018842047 -3 Left 1018842044 6:167524350-167524372 CCAACGACAGGATGAAGAGCCTG No data
Right 1018842047 6:167524370-167524392 CTGAGGCTCCGTAAGCAGCCTGG No data
1018842044_1018842053 17 Left 1018842044 6:167524350-167524372 CCAACGACAGGATGAAGAGCCTG No data
Right 1018842053 6:167524390-167524412 TGGTTGGGAGGCGACACTGCTGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1018842044 Original CRISPR CAGGCTCTTCATCCTGTCGT TGG (reversed) Intergenic
No off target data available for this crispr