ID: 1018845013

View in Genome Browser
Species Human (GRCh38)
Location 6:167549686-167549708
Sequence GGGATGTGAAGAAGGTTAGG AGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total 328
Summary {0: 1, 1: 0, 2: 2, 3: 17, 4: 308}

Found 2 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1018845013_1018845021 24 Left 1018845013 6:167549686-167549708 CCTCCTAACCTTCTTCACATCCC 0: 1
1: 0
2: 2
3: 17
4: 308
Right 1018845021 6:167549733-167549755 AATCTGAGGTGCAGCCTCCGTGG 0: 1
1: 0
2: 0
3: 4
4: 105
1018845013_1018845018 10 Left 1018845013 6:167549686-167549708 CCTCCTAACCTTCTTCACATCCC 0: 1
1: 0
2: 2
3: 17
4: 308
Right 1018845018 6:167549719-167549741 TGACCGATGTTTCCAATCTGAGG 0: 1
1: 0
2: 0
3: 3
4: 69

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1018845013 Original CRISPR GGGATGTGAAGAAGGTTAGG AGG (reversed) Intergenic
904416930 1:30368727-30368749 GGGATGTGAAGAGGGAGAAGGGG - Intergenic
905169441 1:36100444-36100466 AGGGTCTGAAGAAGTTTAGGAGG - Intronic
905301849 1:36990979-36991001 GGGAAGTGAGGATGGTCAGGTGG - Intronic
905689572 1:39932999-39933021 GGGAGGTGAAGGTGGTTAGATGG + Intergenic
906042685 1:42800821-42800843 GGGAAGAGAAGAAGGCTAGAGGG - Intergenic
906141125 1:43534076-43534098 GTGATGTGAACTAGGTTTGGAGG + Intronic
906256964 1:44357733-44357755 GGGAAGTGAAGCAGGGAAGGAGG + Intergenic
906578322 1:46911358-46911380 AGTATGAGAAGAGGGTTAGGGGG - Intergenic
907816056 1:57919177-57919199 GGGTTGTGAGGAGGGTTGGGAGG + Intronic
908642269 1:66238460-66238482 GCTATGTGGAGAAGGTTTGGAGG + Intronic
911470407 1:98311017-98311039 GGGATGTGGAGATGGTTAATTGG + Intergenic
912504551 1:110147329-110147351 GGGGTGAGCAGAAGGCTAGGAGG + Intergenic
912692296 1:111813459-111813481 ATGATGTGAAGAGGGTCAGGAGG - Intronic
913303694 1:117400248-117400270 GGGAGGTGAAGTAGGCTAGACGG - Intronic
914960130 1:152197606-152197628 GGGAGGAGAAGAAGATGAGGAGG - Intergenic
915103601 1:153518059-153518081 GGTATGTGAAGAATTTTGGGAGG - Intergenic
915526922 1:156481480-156481502 GGGATGTGGAAAAGGAAAGGGGG + Intronic
916278416 1:163021556-163021578 GGGAAGTGGAGATGGTTAGTGGG + Intergenic
916977844 1:170100582-170100604 GGGAAGTGATTAAAGTTAGGTGG - Intergenic
918107534 1:181427004-181427026 GAGATGTGAAGAAGCTGAGGTGG - Intronic
919782418 1:201229427-201229449 GGACTGTGAAGAAGGTGAGGAGG - Intergenic
922185088 1:223267110-223267132 GGGATTTGAGGAAGGGGAGGTGG + Intronic
922580702 1:226695757-226695779 GGGAAGAGAAGAAGGACAGGAGG + Intronic
923072059 1:230574855-230574877 GGGATGTGCAGCTGGTTTGGTGG + Intergenic
923739984 1:236646268-236646290 GGGATGTGAAAAGGGGTGGGTGG - Intergenic
924368665 1:243323358-243323380 GGGATGAGAAGATGCTGAGGAGG - Intronic
924466771 1:244305316-244305338 GAGATGGGACGAAGGTTAAGGGG + Intergenic
1063424747 10:5942296-5942318 GGGCTGAGAGGTAGGTTAGGTGG + Intronic
1063967922 10:11361271-11361293 GAGATGTTCAGTAGGTTAGGTGG - Intergenic
1064294748 10:14068563-14068585 GGTATCTGAAAAAGGTTATGGGG + Intronic
1064834997 10:19516758-19516780 GGGAGGAGAAGAAGGTGAAGGGG - Intronic
1065203072 10:23331681-23331703 GGGAAGGGAAGAAGGGAAGGGGG + Intronic
1066061480 10:31727437-31727459 AGGATGTGAACATCGTTAGGGGG - Intergenic
1067554505 10:47259123-47259145 GGGAGTTGAAGAAGGACAGGAGG + Intergenic
1069051054 10:63794681-63794703 GGGAGGTGGAGATGGTTAGTGGG + Intergenic
1070187329 10:74077379-74077401 TGGATGGGAACCAGGTTAGGAGG - Intronic
1071970214 10:90898046-90898068 GGGAGGTGAAGATGGTTAATGGG - Intronic
1072878216 10:99197244-99197266 GGGAGGTGAAGATGGTTAATGGG + Intronic
1075266497 10:121003394-121003416 GTGATGTGAAGAGCGGTAGGTGG - Intergenic
1076888219 10:133272184-133272206 GGGCTGTGAACCAGGTGAGGGGG - Exonic
1078037210 11:7819577-7819599 GGGAAGTGAAGATGGTTAATTGG + Intergenic
1078203679 11:9209067-9209089 TGAAAGTGAAGAAGCTTAGGAGG - Intronic
1078245865 11:9573292-9573314 GGGATCTGAAGAGGGGCAGGCGG - Intergenic
1079248958 11:18773322-18773344 GGGGTGTGAGGAAGGGGAGGGGG + Intronic
1081187305 11:40059650-40059672 AAGAAGTGAAGAAGGTAAGGTGG + Intergenic
1084327057 11:68406561-68406583 GGGGTGTGAAGAAGCACAGGTGG - Exonic
1084942249 11:72618990-72619012 GGGATGTGAGGAAGGAAAGTAGG - Intronic
1085346537 11:75771727-75771749 GGGAAGTGATGTAGGTGAGGGGG - Intronic
1085973289 11:81620781-81620803 AGGAGGGGGAGAAGGTTAGGTGG + Intergenic
1086587857 11:88476663-88476685 GTGATGTGAAAACTGTTAGGTGG + Intergenic
1087538936 11:99490611-99490633 AGAAGGTGAAGTAGGTTAGGAGG + Intronic
1089388251 11:118081986-118082008 GAGATGGGATGAAGGTGAGGGGG - Intronic
1089772756 11:120815265-120815287 CGGGTGTGCAGAAGGTGAGGGGG + Intronic
1090257177 11:125292977-125292999 GGCCTGTGAACAAGGTTAGGTGG - Intronic
1091129580 11:133134252-133134274 GGGAAGTGAAGCAGGTTTTGTGG - Intronic
1091858871 12:3760865-3760887 GGGATGTGCAGGAGGGGAGGAGG - Intronic
1096355526 12:50938020-50938042 GGGATGGCCAGAAGGTTGGGGGG - Intergenic
1096552582 12:52382996-52383018 TGGCTCTGAAGAAGGTAAGGGGG - Exonic
1096829081 12:54300716-54300738 GGGGGGTGAAGGAGGTGAGGGGG - Intronic
1097617718 12:61903267-61903289 GGGAGGGGGAGAAGGATAGGTGG - Intronic
1100912992 12:99387105-99387127 AGCATGTGAAGAACGCTAGGGGG + Intronic
1106412976 13:29523956-29523978 GGGATGTGATAATGGTTTGGGGG + Intronic
1106773204 13:32982713-32982735 GGGATGGGTAGAAGGTGAGGGGG + Intergenic
1108070963 13:46628235-46628257 GGGATGTAAGGAAGGATATGAGG + Intronic
1110276846 13:73650294-73650316 GGGATGTGGCGATGGTTAGTGGG - Intergenic
1110534757 13:76638497-76638519 GGGATTTGAACAAGGGAAGGGGG - Intergenic
1111838281 13:93416666-93416688 GGGAGGTGGAGAAGGTTAATGGG - Intronic
1112314337 13:98348043-98348065 AGGATGTGAAGGAGTTTAAGGGG + Intronic
1112673458 13:101669248-101669270 GGGATGCAAAGAAGGTTATGAGG + Intronic
1112761671 13:102699157-102699179 TGGGTGAGAAGAAGGGTAGGAGG - Intergenic
1113754804 13:112803892-112803914 GGGAGGTGAAGGAGGGAAGGAGG - Intronic
1113754839 13:112803992-112804014 GGGAGGTGAAGGAGGGAAGGAGG - Intronic
1113754859 13:112804053-112804075 GGGAGGTGAAGGAGGGAAGGAGG - Intronic
1113754896 13:112804149-112804171 GGGAGGTGAAGGAGGGAAGGAGG - Intronic
1113754915 13:112804202-112804224 GGGAGGTGAAGGAGGGAAGGAGG - Intronic
1113754932 13:112804245-112804267 GGGAGGTGAAGGAGGGAAGGAGG - Intronic
1113754955 13:112804306-112804328 GGGAGGTGAAGGAGGGAAGGAGG - Intronic
1113754975 13:112804358-112804380 GGGAGGTGAAGGAGGGAAGGAGG - Intronic
1113754998 13:112804419-112804441 GGGAGGTGAAGGAGGGAAGGAGG - Intronic
1114329846 14:21625914-21625936 GGGAAGTGAAGGAGGTCAGTTGG + Intergenic
1114581746 14:23767150-23767172 GGGATCTGAATCAGGGTAGGGGG + Intergenic
1116328594 14:43566951-43566973 AGGAAGTGAACAAGATTAGGTGG + Intergenic
1118116931 14:62789083-62789105 GGGATGTGGAGTAGGGTGGGAGG - Intronic
1119208471 14:72812213-72812235 GGGATGGGAAAAAGGTAAGCGGG - Intronic
1119655988 14:76417367-76417389 GGGATGTGAAGTTGGAAAGGTGG + Intronic
1120005697 14:79355284-79355306 GAGATGTGAAGAAGAGTTGGAGG - Intronic
1121444637 14:93970785-93970807 GTGATGTGAAGCAGGTTACTCGG + Intronic
1123972053 15:25516430-25516452 TGGAGGTGAGGAAGGGTAGGGGG - Intergenic
1123998108 15:25733156-25733178 GTGGTGTGAAGGAGGTTACGGGG + Intronic
1124066807 15:26352543-26352565 GGGAGGAGAATAAGGTTGGGAGG - Intergenic
1124462824 15:29908675-29908697 GAGATGTGAAGTTGGCTAGGAGG + Intronic
1124508025 15:30295679-30295701 GGGATGCGAAGAAGCAGAGGAGG + Intergenic
1124735530 15:32242978-32243000 GGGATGCGAAGAAGCAGAGGAGG - Intergenic
1124957774 15:34370914-34370936 GGGAAGTGAGGAAGGAGAGGAGG - Intergenic
1125241047 15:37576279-37576301 GAGATTTGAAGGGGGTTAGGGGG - Intergenic
1126328081 15:47503905-47503927 GGGATGTGACAAAGGTTAAGTGG - Intronic
1127638568 15:60893953-60893975 GGGCTGTGAAGAAGATGAAGGGG - Intronic
1128070291 15:64791534-64791556 GGGAAGGGAAGGAGCTTAGGTGG - Intergenic
1128579029 15:68795955-68795977 GGGGTCTGAAGAAGGGAAGGAGG + Intronic
1130138233 15:81199386-81199408 TGGATGTGAAGGACGTTGGGTGG + Intronic
1130398271 15:83523986-83524008 AGGAAGTGAAGAAAGTTAGTAGG + Intronic
1130561249 15:84961022-84961044 GGGATGTGAAGAAGTGGAGCCGG - Intergenic
1130965466 15:88694476-88694498 GGCATGTGAAGAAGGAGAGGGGG + Intergenic
1131565337 15:93480306-93480328 GGGATGAGAAGAAGGGAAGTGGG - Intergenic
1132107145 15:99071199-99071221 GGGGTGTGGAGCAGGTGAGGAGG + Intergenic
1132502610 16:291276-291298 GGTATGTGCAGGAGGTTATGCGG - Exonic
1132692867 16:1189334-1189356 GAGATGTGAGGAAGGGGAGGTGG + Intronic
1135841954 16:25884989-25885011 GGGCAGTCAGGAAGGTTAGGAGG + Intronic
1136034786 16:27531004-27531026 GGGATGGGAAGAAGGTGGCGAGG - Intronic
1138040044 16:53653684-53653706 AGAATGAGAAGAAGGATAGGAGG - Intronic
1140297542 16:73724105-73724127 GAGGGGTGAATAAGGTTAGGTGG + Intergenic
1140310599 16:73844616-73844638 GGGATGGGAAGATGGGTAGAGGG + Intergenic
1140393254 16:74606648-74606670 AGGATGTGAGGGAGGTGAGGAGG - Exonic
1140546684 16:75816512-75816534 TGAATGTGAAGAAGGTCTGGAGG - Intergenic
1143015101 17:3887474-3887496 AGGAGGTGAAGGAGGTGAGGAGG + Intronic
1143108227 17:4539973-4539995 GGGAAGTGAGCAAGGTTAGAAGG + Intronic
1143321593 17:6071960-6071982 GGGATCTGAAGGAGGCTTGGCGG + Intronic
1144169936 17:12649790-12649812 GGTATGTGCAGAAGGAGAGGGGG + Intergenic
1144486409 17:15668668-15668690 AGGATGGGAAGAATGTTTGGTGG - Intronic
1144779397 17:17800322-17800344 GGGCTGTGAAGCAGGGGAGGTGG - Intronic
1144914611 17:18713624-18713646 AGGATGGGAAGAATGTTTGGTGG + Intronic
1146322483 17:31858022-31858044 TGGATGGGAAGGTGGTTAGGAGG - Intronic
1146976543 17:37118011-37118033 GGGATGTGAAGAATGACAAGAGG + Intronic
1147776811 17:42907695-42907717 GGGATGTGAGGAAGAATACGTGG - Intronic
1148160987 17:45450001-45450023 TGGATGAGCAGATGGTTAGGTGG - Intronic
1148160996 17:45450041-45450063 TGGATGAGCAGATGGTTAGGTGG - Intronic
1149355450 17:55834759-55834781 GGGATGTGAAAAAGAGGAGGGGG + Intronic
1150392233 17:64796696-64796718 TGGATGAGCAGATGGTTAGGTGG - Intergenic
1152188882 17:78876097-78876119 TGGATGAGAGGATGGTTAGGAGG - Intronic
1153682091 18:7510476-7510498 TGGATGTGCTGAAGGATAGGAGG + Intergenic
1155545118 18:26906820-26906842 GGGAGGTGAAGGGGGGTAGGTGG + Exonic
1156183941 18:34639539-34639561 GGGGTGTGAAGAAGGCTTGGAGG - Intronic
1157135432 18:45049631-45049653 GGGTTATGAAGAAAGGTAGGAGG - Intronic
1157440983 18:47711495-47711517 GGGAGGGGAAGAAGGTCATGGGG + Intergenic
1157498790 18:48175259-48175281 GGGATGAGAGGAAGGTTTGTTGG + Intronic
1158241588 18:55384686-55384708 AGGATGGGAAAAAGGTCAGGTGG - Intronic
1158358960 18:56650678-56650700 GGGACGTGAAGTAGGTGAAGTGG - Intronic
1158507399 18:58058763-58058785 GGGATGTGAAGAGGGATAGTTGG - Intronic
1161268138 19:3374673-3374695 GGGATGTGTAGGAGTTTGGGAGG + Intronic
1162390852 19:10389233-10389255 GGCATGTGAGGCAGGTTTGGTGG + Intergenic
1163262997 19:16202483-16202505 GGGGTGTGAAGAAGCTTTCGGGG - Intronic
1163759914 19:19130569-19130591 GGGATGTGAAGTAGGTGAGGTGG - Intronic
1164920842 19:32087516-32087538 GGGATATTCAGAACGTTAGGAGG + Intergenic
1165643507 19:37411208-37411230 GGGATGTGGGAAAGGTTTGGTGG - Exonic
1167762796 19:51459876-51459898 GGGCTGGGAAGAAGTTAAGGGGG + Intergenic
1168430333 19:56273998-56274020 GGGATAAGTAGAAGGTTACGAGG + Intronic
926234232 2:11027414-11027436 GGGACGTGAAGAAGGAGGGGAGG - Intergenic
926745989 2:16158836-16158858 GGGATGTGAGGGTGGTAAGGTGG - Intergenic
927063698 2:19448181-19448203 GGGATGTGAGGAAGATGAAGAGG + Intergenic
927287274 2:21369843-21369865 GGGAGGGGAAGAAGGGGAGGAGG - Intergenic
927971993 2:27311681-27311703 GGGAGATGAAGAAGGTCAGTGGG + Intronic
928507126 2:31965282-31965304 GGGAAGGGAAGAAGGGAAGGAGG + Intronic
931665079 2:64604626-64604648 GGGATCTAGAGAAGGTTGGGGGG - Intergenic
932624935 2:73290036-73290058 GGGATCAGAGGAAGGCTAGGAGG - Intergenic
932886208 2:75551485-75551507 GGGATGTGCAGAAAGGCAGGAGG - Intronic
933795328 2:85914946-85914968 GGGATGTGGGCAAGGTTAAGGGG - Intergenic
935070882 2:99692496-99692518 GGGCCTGGAAGAAGGTTAGGAGG + Intronic
935081457 2:99800926-99800948 GGTGTGTGGAGAAGGGTAGGAGG + Intronic
936410337 2:112252762-112252784 GGGACCTGAAGGAGGTGAGGGGG - Intronic
936574383 2:113641297-113641319 GGGAAGGGAAGAAGGTTTGGAGG - Intronic
937066589 2:119022540-119022562 AGGATGGGAAGCAGGCTAGGAGG + Intergenic
937135104 2:119544975-119544997 GGGAAGGGAAGCAGGTGAGGAGG + Intronic
937234672 2:120423482-120423504 GGGATGGGAAGAAGGGAATGAGG - Intergenic
937492327 2:122382911-122382933 ACGATGTGAATAAGGTTAAGAGG - Intergenic
937660856 2:124428258-124428280 GGGAGGGGCAGAGGGTTAGGAGG - Intronic
939049237 2:137287760-137287782 TGGATGTGAAGATGGGTGGGTGG + Intronic
939425078 2:142025155-142025177 GGGATGGGAAGAAAGTTGTGAGG - Intronic
939964638 2:148598435-148598457 TGGATGTCAAGAAGATGAGGAGG + Intergenic
941571227 2:167173242-167173264 GGGAAGTGAAGATGGTTAATGGG - Intronic
941712393 2:168727936-168727958 AGGATGTGAAAGAGGTTAGATGG + Intronic
942568005 2:177285576-177285598 GGGGTGGGATGAAGGTTTGGTGG - Intronic
942664567 2:178303864-178303886 GGGAAGTAAAGAAGATGAGGAGG - Intronic
944097275 2:195982844-195982866 GGGATGTGGTGATGGTTAGTGGG + Intronic
946397907 2:219452517-219452539 GGGAGGTGAGGATGGTCAGGGGG + Intronic
946684772 2:222256514-222256536 GGGACTTGGAGGAGGTTAGGGGG - Intronic
1169853874 20:10082533-10082555 AGGAAGTGAAGAAGGTAAGAAGG + Intergenic
1170951033 20:20936489-20936511 GGGGCGTGGAGAAGGTTTGGTGG - Intergenic
1171214363 20:23341604-23341626 GGGATGTGAGGTAGGGCAGGGGG + Intergenic
1171944666 20:31365904-31365926 GGGACATGAAGAATGTTTGGGGG + Intergenic
1172412848 20:34739073-34739095 GGGAAGGGAAGAAGGGAAGGAGG + Intronic
1173163794 20:40671839-40671861 AGGATGGGAAGGATGTTAGGAGG + Intergenic
1173807324 20:45934556-45934578 CGGATGGGAAGAAGGGGAGGGGG + Intergenic
1174459352 20:50671943-50671965 TGGATGAGTAGATGGTTAGGTGG + Intronic
1174965021 20:55202930-55202952 GAAATGAGAAGAAGCTTAGGAGG + Intergenic
1177951860 21:27548124-27548146 GGGCAGAGAAGAAGGCTAGGAGG + Intergenic
1178235202 21:30833795-30833817 GGGAAGTGAAGCAGGGAAGGTGG - Intergenic
1178872841 21:36390441-36390463 GGGATGGTCAGAAGGTTACGTGG + Intronic
1179062380 21:37990821-37990843 GGTATGTGAAGAATCTTTGGTGG - Intronic
1181172256 22:21016260-21016282 GGGATGTGTAGGAGGTTTTGGGG + Intronic
1181381213 22:22506074-22506096 GGGATGTGAAGGAGAGGAGGAGG + Intronic
1181580400 22:23824941-23824963 GAGATGGGATGAAGGTAAGGTGG + Intronic
1183198672 22:36370860-36370882 GGGGTGGGAAGAAGGGCAGGAGG + Intronic
1184358114 22:43996056-43996078 GGAACGTGAAGGAGGTGAGGAGG + Intronic
1184464685 22:44661778-44661800 GGGAAGAGAAGGAGGTGAGGAGG + Intergenic
1185121836 22:48976010-48976032 GGGATGAGAGGAAGGTTTGATGG - Intergenic
1185123873 22:48993136-48993158 GGGAGGGGAAGAAGGAGAGGAGG - Intergenic
1185425787 22:50769590-50769612 GGGAAGGGAAGAAGGTTTGGAGG + Intronic
950372071 3:12539503-12539525 GGGATGTGAAGACAGCAAGGTGG - Intronic
951093991 3:18607303-18607325 GGGATCTGGAGAAAGGTAGGTGG + Intergenic
951688519 3:25371308-25371330 GGGATGTGGACAAGGCTTGGGGG + Intronic
952845806 3:37686945-37686967 GGGTTGTTAAGCAGGTTGGGGGG - Intronic
953789776 3:45938372-45938394 GGGCTGTGAATCAGTTTAGGAGG + Intronic
954675254 3:52311979-52312001 GGGCTGGGAAGCAGGTTGGGGGG - Intergenic
958636437 3:96752746-96752768 GGGATGGGGAGAAGTTAAGGAGG + Intergenic
959143390 3:102513741-102513763 AGGATGTGATCAAGGTTGGGAGG - Intergenic
959205227 3:103298408-103298430 GGGATGGGAAGAAGGAAGGGAGG - Intergenic
960847270 3:122016112-122016134 GAGATGAGAAGAATGTTAGCGGG - Intronic
960872656 3:122265406-122265428 GGGATGTGAGGAGGGCTTGGGGG - Intronic
961000667 3:123371914-123371936 GGGATTTGAAGAAGGTGGGCAGG + Intronic
963199919 3:142575595-142575617 GGGATGTGGAGGAGGTTCTGAGG - Intronic
965393997 3:168139909-168139931 GGTAAGTGAAGCAGGTTAGTGGG - Intergenic
965529764 3:169759802-169759824 GGGATGTGAAGAGGGTTCCAAGG - Intergenic
967470140 3:189851652-189851674 GGGAAGTGAACAAGGGCAGGCGG + Intronic
967791534 3:193554705-193554727 GGGATGGGAAGAAGGGAATGTGG + Intronic
969155979 4:5210311-5210333 GGGAAGGGCAGAAGGTCAGGTGG - Intronic
970195164 4:13544734-13544756 GGGACGTGAAGGAGGATTGGCGG + Exonic
970589411 4:17546367-17546389 GGGCTGAGAAGCAGGATAGGTGG + Intergenic
971174487 4:24267591-24267613 GGGGTGAGAAGAGGGTGAGGAGG + Intergenic
972714592 4:41632895-41632917 GGGAGGTGAAGGAGGACAGGTGG + Intronic
972734070 4:41823212-41823234 GGGATGTTCTGAAGGTAAGGAGG + Intergenic
974131415 4:57760912-57760934 GGGATGGGAAGTGGGTTAGTTGG + Intergenic
974397640 4:61359432-61359454 GGGAGGAGAAGAATGGTAGGAGG - Intronic
975080039 4:70266070-70266092 GGGATGTGGGGATGGTTAAGGGG + Intergenic
975587602 4:75965972-75965994 GGGACCTGAAGAAAGTGAGGGGG - Intronic
978117344 4:105036104-105036126 GGGATATGAGGAAGGTTAATGGG + Intergenic
979688298 4:123535539-123535561 GGGATGTGGAGCAGGGTGGGAGG + Intergenic
981276632 4:142906433-142906455 GGGCTGTGAAGAAAGTTAAAAGG - Intergenic
983257083 4:165411877-165411899 GGAATGGGAAGAAGGGTAGTGGG + Intronic
984736838 4:183117102-183117124 GGGATATGCAGAAGTGTAGGTGG - Intronic
984832224 4:183986474-183986496 AGGATGTGAAAAGCGTTAGGTGG + Intronic
985529759 5:426989-427011 TGGATGTGAAGATGGATGGGTGG + Intronic
986347844 5:6851022-6851044 GGCATGTGTAGGAGGTGAGGAGG + Intergenic
986845355 5:11745679-11745701 GGCATGAGAGGCAGGTTAGGAGG - Intronic
988853237 5:35199680-35199702 GGGATATCAAGTAGGTTATGTGG - Intronic
989730128 5:44639036-44639058 GAGATAGGAAGAAGGTTGGGTGG + Intergenic
990921108 5:60968825-60968847 GGGAAGTGGAGATGGTTAAGTGG - Intronic
991095937 5:62739664-62739686 GGGATGGGATGAAGGTAAGGGGG + Intergenic
992030973 5:72721307-72721329 GGGAAAAGAAGAAGGATAGGAGG - Intergenic
994049664 5:95348322-95348344 GGGATGAGAAGATGCTTAGCAGG - Intergenic
994107902 5:95966651-95966673 GGGCTGAGTAGAAGGCTAGGTGG + Intergenic
995098600 5:108270960-108270982 GGAATGTGGAGAAGGAGAGGGGG - Intronic
996009685 5:118468216-118468238 GGGATGACAAGTAGGATAGGGGG - Intergenic
996381085 5:122863243-122863265 GGGACCTGAAGGAGGTGAGGGGG + Intronic
996484773 5:124019537-124019559 GGGAAGTGGAGATGGTTAGTGGG - Intergenic
998424566 5:142015409-142015431 GGGCTGTAAGGAGGGTTAGGAGG - Intergenic
1001313115 5:170625171-170625193 GGGCTCTGAAGAAGGTGAGCAGG - Intronic
1002685237 5:181004602-181004624 GAGATCTGAAGAAGGCTATGGGG - Intronic
1002851823 6:1003497-1003519 GTGAGGTGAAGAAGGTTCGCTGG - Intergenic
1002937705 6:1687670-1687692 GGCAGGTGAAGAACGTGAGGGGG + Intronic
1003324585 6:5082927-5082949 GGCCTGTGAGGAAGGTGAGGTGG - Intergenic
1003841724 6:10127513-10127535 GTGATGTGAAGAGGGCTAGATGG - Intronic
1007500996 6:42296742-42296764 GGGAAGGGAAGAAGGTGAGAAGG + Intronic
1008600362 6:53088106-53088128 GAGATGTGAAGAAAGTTACAAGG - Intronic
1011262496 6:85483950-85483972 GGTATGTGATGAGGGTTGGGAGG - Intronic
1012275345 6:97266829-97266851 GGGCTGTGAGGAGGATTAGGAGG + Intronic
1012365141 6:98429781-98429803 GGGTTGGCAAGAAGGGTAGGGGG - Intergenic
1013000156 6:106013841-106013863 GGGAGGGGAACAAGATTAGGGGG - Intergenic
1013180031 6:107709462-107709484 GGGATGTGGGGAAGGTAGGGAGG - Intronic
1013845878 6:114450906-114450928 CGGCTGTGAAGAAGTTTAAGAGG - Intergenic
1014432927 6:121390604-121390626 GGGATGTGGAGAAGGGAGGGAGG - Intergenic
1014652145 6:124052964-124052986 GGGATGGAGAGAAGGTGAGGGGG + Intronic
1015818800 6:137238152-137238174 CGGATGTGGAGAAGATGAGGAGG - Intergenic
1017011762 6:150068261-150068283 TGGATGTGATGAATGTGAGGGGG - Intronic
1017102613 6:150862187-150862209 GTGATGTGGAGAAGGTCAGAGGG - Intergenic
1018234481 6:161710836-161710858 GGGAAGGGAAGAAGGAAAGGGGG - Intronic
1018845013 6:167549686-167549708 GGGATGTGAAGAAGGTTAGGAGG - Intergenic
1018846690 6:167561808-167561830 GGGATGTGGAGCAGGGCAGGAGG - Intergenic
1021694702 7:23265533-23265555 GAGATGTGAGGAAGGAAAGGAGG - Intronic
1021866771 7:24965997-24966019 TGGATGTGAAGGGGGTTTGGAGG - Intronic
1023121459 7:36913320-36913342 GGAATGTCAACAAGGTTAGATGG + Intronic
1024509718 7:50194124-50194146 GAGATGGGAAAGAGGTTAGGGGG + Intergenic
1024730389 7:52247234-52247256 GGCATGGGAAGCAGGTCAGGTGG + Intergenic
1025031579 7:55561283-55561305 GGGATGTGAGGAAGGAGATGAGG - Intronic
1027135204 7:75618954-75618976 GGGATGTCAAGGATGTTGGGTGG - Intronic
1028944653 7:96563333-96563355 GGGATGTGCTGGAGGTTTGGGGG + Intronic
1029726406 7:102408535-102408557 GGGCTGTGAATAAGGGTGGGGGG + Intronic
1030032006 7:105378092-105378114 GGAATGTCAAGCAGGTTAGTAGG - Intronic
1030715116 7:112800577-112800599 GCCAGGTGAAGATGGTTAGGGGG - Intergenic
1030739812 7:113095412-113095434 GGCATGTGAACAAGCTTAGGAGG + Intergenic
1031976724 7:128098601-128098623 GGGAGGTGAGGAAGGTTTTGAGG + Intergenic
1032309790 7:130774453-130774475 GGAAGGGGAAGAAGGGTAGGAGG - Intergenic
1033403996 7:141054423-141054445 GGGAGGTAACTAAGGTTAGGGGG - Intergenic
1034355990 7:150451119-150451141 AGGATGTGAGGAAGGTGAGGAGG - Exonic
1034449731 7:151130853-151130875 GGGAGATGAAGGAGGTGAGGTGG - Intronic
1034467572 7:151238904-151238926 GGGAAGGGAAGAAGGTGGGGAGG - Intronic
1036132973 8:6133522-6133544 GGGAGGTGAAGGAGGTCTGGAGG + Intergenic
1037316456 8:17604001-17604023 GGAGTGGGAAGGAGGTTAGGAGG + Intronic
1037879720 8:22566700-22566722 GGGAAGAGAAGAAGGTAAGGAGG + Exonic
1038328501 8:26589940-26589962 GGGCTGGGAGGAAGGTGAGGTGG + Intronic
1038477223 8:27876818-27876840 AGGGTGAGAAGAAGGCTAGGAGG + Intronic
1039396699 8:37231865-37231887 GGGATGGGAGGAAGGTCAGAAGG + Intergenic
1039474889 8:37834397-37834419 GGGATGGGAGGAAGGCTTGGTGG + Intronic
1039585598 8:38704551-38704573 AGGATGTGAGGCAGGGTAGGGGG + Intergenic
1039600090 8:38829268-38829290 GGGATGAGAAGGAGGCCAGGGGG - Intronic
1039771026 8:40686951-40686973 GGGCTGTGAAGAACATGAGGCGG + Intronic
1040846991 8:51854103-51854125 GTGATGTGAAGTGGCTTAGGTGG - Intronic
1041476837 8:58276850-58276872 GGGATCTCAAGAATGTTAGTTGG + Intergenic
1042898937 8:73702101-73702123 GGGATGGGAAGATGGTTAATGGG + Intronic
1044780126 8:95735184-95735206 GGGATGAGGAGAGGGGTAGGAGG - Intergenic
1044915659 8:97110562-97110584 GGGATGTGAAGAATGAAAAGGGG - Intronic
1045025611 8:98083860-98083882 GGGATGGGAAGAGGGATAGATGG - Intronic
1045343045 8:101271238-101271260 GGGACGTGAAGAAAGAAAGGAGG + Intergenic
1045345679 8:101291441-101291463 GGGATGGGGAGAGGGGTAGGGGG + Intergenic
1046555430 8:115768232-115768254 GGGAAGGGAAGAAGGGAAGGGGG - Intronic
1047235710 8:123040338-123040360 GAGATCTGAAGAAGGTTAGGAGG + Intronic
1050877755 9:10661331-10661353 GTGATGTGAAGGAGGTTGTGAGG + Intergenic
1051576555 9:18622511-18622533 GGCATGTGAATTAGCTTAGGTGG + Intronic
1054728874 9:68680208-68680230 GGGATGTGAGAAAAGTTAGTGGG - Intergenic
1056141173 9:83681558-83681580 GAAACGTGAAGAAGGTTAGGAGG + Intronic
1059467531 9:114478544-114478566 GGGATGAGAAAAAGGTGAGTGGG - Exonic
1061252860 9:129436787-129436809 GGGATGAGAGGAAGGAGAGGAGG - Intergenic
1061661170 9:132131295-132131317 GGGATGGGGAGCAGGGTAGGGGG + Intergenic
1062136957 9:134934169-134934191 GGGATGAGAAGAAGGGTGGCAGG + Intergenic
1062571563 9:137188161-137188183 GGGAAGGGAAGAAGCTGAGGGGG + Intronic
1185603558 X:1354863-1354885 GGGAAGAGAAGGAGGTGAGGAGG + Intronic
1186136071 X:6522479-6522501 GGGGTGGGAGGAAGGTGAGGTGG + Intergenic
1186907071 X:14122426-14122448 GGAAACTGAAGGAGGTTAGGAGG - Intergenic
1190278499 X:48914242-48914264 GGGTCGGGAAGAAGGTTTGGGGG + Exonic
1193033357 X:76923542-76923564 GAGATGTGAAGAAGGAGAGGAGG - Intergenic
1193430257 X:81393263-81393285 GTAATGTAAAGAAGGTGAGGTGG - Intergenic
1193743144 X:85243302-85243324 GAGATGTGATGAAAGGTAGGTGG - Intergenic
1194789033 X:98122667-98122689 GGGAAGTGAAGATGGTTAATCGG + Intergenic
1195745753 X:108116355-108116377 GGTATGGGAAGAGGGTGAGGTGG + Intronic
1196329302 X:114451217-114451239 AGGATTTGAAGCAGCTTAGGAGG - Intergenic
1197254652 X:124250017-124250039 GGTGTGTGAAGAATGGTAGGCGG + Intronic
1197899373 X:131353706-131353728 GGGAATTGAAGAAGGGGAGGTGG + Intronic
1199111331 X:143938313-143938335 GGGATGTGGAGATGGTTAATGGG + Intergenic
1199761669 X:150909284-150909306 AGGATGAGAAGGAGGTGAGGGGG + Intergenic