ID: 1018847514

View in Genome Browser
Species Human (GRCh38)
Location 6:167565957-167565979
Strand +
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 1 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1018847509_1018847514 9 Left 1018847509 6:167565925-167565947 CCAGCTAGCTGCGTCTTATCAGT No data
Right 1018847514 6:167565957-167565979 TCCCACACCCTCCTAGCTCAGGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1018847514 Original CRISPR TCCCACACCCTCCTAGCTCA GGG Intergenic
No off target data available for this crispr