ID: 1018847949

View in Genome Browser
Species Human (GRCh38)
Location 6:167568070-167568092
Sequence CTGGCCACTGAGAGAGAACA TGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 1 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1018847949_1018847952 -6 Left 1018847949 6:167568070-167568092 CCATGTTCTCTCTCAGTGGCCAG No data
Right 1018847952 6:167568087-167568109 GGCCAGTCTCTGGGCCAGACCGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1018847949 Original CRISPR CTGGCCACTGAGAGAGAACA TGG (reversed) Intergenic
No off target data available for this crispr