ID: 1018849657

View in Genome Browser
Species Human (GRCh38)
Location 6:167577925-167577947
Sequence GTGGCAGTGCTGATGGCTGG AGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 7 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1018849657_1018849662 -9 Left 1018849657 6:167577925-167577947 CCTCCAGCCATCAGCACTGCCAC No data
Right 1018849662 6:167577939-167577961 CACTGCCACCCCTGGATCTTGGG No data
1018849657_1018849666 -3 Left 1018849657 6:167577925-167577947 CCTCCAGCCATCAGCACTGCCAC No data
Right 1018849666 6:167577945-167577967 CACCCCTGGATCTTGGGCAGGGG No data
1018849657_1018849671 4 Left 1018849657 6:167577925-167577947 CCTCCAGCCATCAGCACTGCCAC No data
Right 1018849671 6:167577952-167577974 GGATCTTGGGCAGGGGCATCGGG No data
1018849657_1018849670 3 Left 1018849657 6:167577925-167577947 CCTCCAGCCATCAGCACTGCCAC No data
Right 1018849670 6:167577951-167577973 TGGATCTTGGGCAGGGGCATCGG No data
1018849657_1018849665 -4 Left 1018849657 6:167577925-167577947 CCTCCAGCCATCAGCACTGCCAC No data
Right 1018849665 6:167577944-167577966 CCACCCCTGGATCTTGGGCAGGG No data
1018849657_1018849661 -10 Left 1018849657 6:167577925-167577947 CCTCCAGCCATCAGCACTGCCAC No data
Right 1018849661 6:167577938-167577960 GCACTGCCACCCCTGGATCTTGG No data
1018849657_1018849663 -5 Left 1018849657 6:167577925-167577947 CCTCCAGCCATCAGCACTGCCAC No data
Right 1018849663 6:167577943-167577965 GCCACCCCTGGATCTTGGGCAGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1018849657 Original CRISPR GTGGCAGTGCTGATGGCTGG AGG (reversed) Intergenic
No off target data available for this crispr