ID: 1018849938

View in Genome Browser
Species Human (GRCh38)
Location 6:167579662-167579684
Sequence GTCACATGTGCTCACGTAAC AGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 5 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1018849938_1018849942 9 Left 1018849938 6:167579662-167579684 CCTGTTACGTGAGCACATGTGAC No data
Right 1018849942 6:167579694-167579716 ACCCGTTGCCATTGGGCCCTGGG No data
1018849938_1018849940 2 Left 1018849938 6:167579662-167579684 CCTGTTACGTGAGCACATGTGAC No data
Right 1018849940 6:167579687-167579709 TGCGCTGACCCGTTGCCATTGGG No data
1018849938_1018849939 1 Left 1018849938 6:167579662-167579684 CCTGTTACGTGAGCACATGTGAC No data
Right 1018849939 6:167579686-167579708 CTGCGCTGACCCGTTGCCATTGG No data
1018849938_1018849941 8 Left 1018849938 6:167579662-167579684 CCTGTTACGTGAGCACATGTGAC No data
Right 1018849941 6:167579693-167579715 GACCCGTTGCCATTGGGCCCTGG No data
1018849938_1018849944 10 Left 1018849938 6:167579662-167579684 CCTGTTACGTGAGCACATGTGAC No data
Right 1018849944 6:167579695-167579717 CCCGTTGCCATTGGGCCCTGGGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1018849938 Original CRISPR GTCACATGTGCTCACGTAAC AGG (reversed) Intergenic
No off target data available for this crispr