ID: 1018849941

View in Genome Browser
Species Human (GRCh38)
Location 6:167579693-167579715
Strand +
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 2 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1018849938_1018849941 8 Left 1018849938 6:167579662-167579684 CCTGTTACGTGAGCACATGTGAC No data
Right 1018849941 6:167579693-167579715 GACCCGTTGCCATTGGGCCCTGG No data
1018849937_1018849941 17 Left 1018849937 6:167579653-167579675 CCACTGGCACCTGTTACGTGAGC No data
Right 1018849941 6:167579693-167579715 GACCCGTTGCCATTGGGCCCTGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1018849941 Original CRISPR GACCCGTTGCCATTGGGCCC TGG Intergenic
No off target data available for this crispr