ID: 1018850045

View in Genome Browser
Species Human (GRCh38)
Location 6:167580744-167580766
Sequence ACTCTGAGCCCACTCTGAGC TGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total
Summary

Found 5 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1018850045_1018850052 14 Left 1018850045 6:167580744-167580766 CCAGCTCAGAGTGGGCTCAGAGT No data
Right 1018850052 6:167580781-167580803 ATTGCACAAGACTCTTCACTGGG No data
1018850045_1018850047 -9 Left 1018850045 6:167580744-167580766 CCAGCTCAGAGTGGGCTCAGAGT No data
Right 1018850047 6:167580758-167580780 GCTCAGAGTGGCGCCTGCCCAGG No data
1018850045_1018850054 19 Left 1018850045 6:167580744-167580766 CCAGCTCAGAGTGGGCTCAGAGT No data
Right 1018850054 6:167580786-167580808 ACAAGACTCTTCACTGGGAAGGG No data
1018850045_1018850051 13 Left 1018850045 6:167580744-167580766 CCAGCTCAGAGTGGGCTCAGAGT No data
Right 1018850051 6:167580780-167580802 GATTGCACAAGACTCTTCACTGG No data
1018850045_1018850053 18 Left 1018850045 6:167580744-167580766 CCAGCTCAGAGTGGGCTCAGAGT No data
Right 1018850053 6:167580785-167580807 CACAAGACTCTTCACTGGGAAGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1018850045 Original CRISPR ACTCTGAGCCCACTCTGAGC TGG (reversed) Intergenic