ID: 1018854319

View in Genome Browser
Species Human (GRCh38)
Location 6:167664555-167664577
Sequence CTCTTGTGAATACAATCATG AGG
Strand +
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 4 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1018854313_1018854319 22 Left 1018854313 6:167664510-167664532 CCTGCCTTTCAGACACGGATAAT No data
Right 1018854319 6:167664555-167664577 CTCTTGTGAATACAATCATGAGG No data
1018854317_1018854319 -5 Left 1018854317 6:167664537-167664559 CCTGCAGATACCATCAGGCTCTT No data
Right 1018854319 6:167664555-167664577 CTCTTGTGAATACAATCATGAGG No data
1018854312_1018854319 23 Left 1018854312 6:167664509-167664531 CCCTGCCTTTCAGACACGGATAA No data
Right 1018854319 6:167664555-167664577 CTCTTGTGAATACAATCATGAGG No data
1018854314_1018854319 18 Left 1018854314 6:167664514-167664536 CCTTTCAGACACGGATAATGTGG No data
Right 1018854319 6:167664555-167664577 CTCTTGTGAATACAATCATGAGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1018854319 Original CRISPR CTCTTGTGAATACAATCATG AGG Intergenic
No off target data available for this crispr