ID: 1018855238

View in Genome Browser
Species Human (GRCh38)
Location 6:167670036-167670058
Sequence CCACGCCATAAGAGAGGCTC AGG
Strand +
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total 92
Summary {0: 1, 1: 0, 2: 0, 3: 6, 4: 85}

Found 9 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1018855228_1018855238 28 Left 1018855228 6:167669985-167670007 CCATAAGAAGAGCCCCTCCCGGC 0: 1
1: 0
2: 0
3: 7
4: 95
Right 1018855238 6:167670036-167670058 CCACGCCATAAGAGAGGCTCAGG 0: 1
1: 0
2: 0
3: 6
4: 85
1018855233_1018855238 10 Left 1018855233 6:167670003-167670025 CCGGCAGACAAAACCCTCTCATG 0: 1
1: 0
2: 0
3: 11
4: 106
Right 1018855238 6:167670036-167670058 CCACGCCATAAGAGAGGCTCAGG 0: 1
1: 0
2: 0
3: 6
4: 85
1018855235_1018855238 -4 Left 1018855235 6:167670017-167670039 CCTCTCATGTGTGACTCAACCAC 0: 1
1: 0
2: 2
3: 6
4: 79
Right 1018855238 6:167670036-167670058 CCACGCCATAAGAGAGGCTCAGG 0: 1
1: 0
2: 0
3: 6
4: 85
1018855230_1018855238 15 Left 1018855230 6:167669998-167670020 CCCTCCCGGCAGACAAAACCCTC 0: 1
1: 0
2: 0
3: 10
4: 83
Right 1018855238 6:167670036-167670058 CCACGCCATAAGAGAGGCTCAGG 0: 1
1: 0
2: 0
3: 6
4: 85
1018855226_1018855238 29 Left 1018855226 6:167669984-167670006 CCCATAAGAAGAGCCCCTCCCGG 0: 1
1: 0
2: 0
3: 6
4: 52
Right 1018855238 6:167670036-167670058 CCACGCCATAAGAGAGGCTCAGG 0: 1
1: 0
2: 0
3: 6
4: 85
1018855232_1018855238 11 Left 1018855232 6:167670002-167670024 CCCGGCAGACAAAACCCTCTCAT 0: 1
1: 0
2: 0
3: 12
4: 156
Right 1018855238 6:167670036-167670058 CCACGCCATAAGAGAGGCTCAGG 0: 1
1: 0
2: 0
3: 6
4: 85
1018855234_1018855238 -3 Left 1018855234 6:167670016-167670038 CCCTCTCATGTGTGACTCAACCA 0: 1
1: 0
2: 4
3: 11
4: 127
Right 1018855238 6:167670036-167670058 CCACGCCATAAGAGAGGCTCAGG 0: 1
1: 0
2: 0
3: 6
4: 85
1018855231_1018855238 14 Left 1018855231 6:167669999-167670021 CCTCCCGGCAGACAAAACCCTCT 0: 1
1: 0
2: 0
3: 11
4: 76
Right 1018855238 6:167670036-167670058 CCACGCCATAAGAGAGGCTCAGG 0: 1
1: 0
2: 0
3: 6
4: 85
1018855229_1018855238 16 Left 1018855229 6:167669997-167670019 CCCCTCCCGGCAGACAAAACCCT 0: 1
1: 0
2: 2
3: 8
4: 106
Right 1018855238 6:167670036-167670058 CCACGCCATAAGAGAGGCTCAGG 0: 1
1: 0
2: 0
3: 6
4: 85

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1018855238 Original CRISPR CCACGCCATAAGAGAGGCTC AGG Intergenic
905611947 1:39360812-39360834 CCAGGCTATAGGAGAGGCTTTGG - Exonic
908700570 1:66895350-66895372 CCACGCCACATGGGAGGCTAAGG + Intronic
908757718 1:67484433-67484455 CCAAGCCATCAGAAAGCCTCCGG - Intergenic
909156526 1:72084601-72084623 CCAGGCAGTAAAAGAGGCTCTGG - Intronic
910763081 1:90754258-90754280 CCACTACAGAAGAGAGGCTTGGG + Intergenic
913692435 1:121291914-121291936 AAACTCAATAAGAGAGGCTCAGG + Intronic
913709600 1:121469477-121469499 CCAAGCCAGAAGAGAGGCAGAGG - Intergenic
914145122 1:144988188-144988210 AAACTCAATAAGAGAGGCTCAGG - Intronic
915075169 1:153302306-153302328 CCAGCCCAAAGGAGAGGCTCAGG + Intronic
920479756 1:206310271-206310293 AAACTCAATAAGAGAGGCTCAGG + Intronic
921184172 1:212655919-212655941 CCAGGCCATAAGAGGGGTTGGGG - Intergenic
1072717684 10:97762498-97762520 GCACCCCCTAAGAGAGGCCCTGG + Intergenic
1073202232 10:101744992-101745014 CCAGGCCCTATGGGAGGCTCTGG + Intergenic
1073232551 10:101984493-101984515 CCAGGCCATACGAGAGGTGCTGG - Intronic
1075747885 10:124740805-124740827 CCACGCCACAAAACAGGGTCTGG - Intronic
1079116415 11:17643295-17643317 CCAGGCCATAGGAGAGCCACGGG - Intronic
1081692857 11:45089774-45089796 CCCTGCCATAAGAGAGGCCCAGG - Intergenic
1084323073 11:68384345-68384367 CCAGGGCATCAGGGAGGCTCTGG + Intronic
1090729147 11:129554878-129554900 CTACGGCAAAAGAGAGGCTTAGG + Intergenic
1092442423 12:8518181-8518203 TCACGCTGTAAGAGAGGCACAGG + Exonic
1103402340 12:120651494-120651516 CCAGGCCATAGAAGAGACTCAGG + Intronic
1106396324 13:29384484-29384506 ACAGGCCATGAGAGAAGCTCAGG + Intronic
1110805130 13:79745402-79745424 CCACAGCAGAAGAGAGGCCCAGG + Intergenic
1115201011 14:30854193-30854215 CCACTCCATAAGAGGGACACAGG - Intergenic
1116833119 14:49741954-49741976 CCACTCCATAGGAGCAGCTCTGG - Intronic
1117194594 14:53327099-53327121 CCAAGCCATGGGAGAGGCTCTGG + Intergenic
1117405500 14:55398654-55398676 CAAAGCCATAAGACAGTCTCAGG - Intronic
1119727981 14:76933598-76933620 CCAATCCAGAAGAGAGGCCCTGG - Intergenic
1119774744 14:77241270-77241292 CCTCACCATAAGAGAGCGTCAGG + Intronic
1122968215 14:105141653-105141675 CCACGCCGGCAGAGAGGCTTGGG - Exonic
1124212438 15:27774839-27774861 GCAGGCCACGAGAGAGGCTCAGG + Intronic
1125888356 15:43246567-43246589 CCAGGCCACAACACAGGCTCGGG + Intronic
1126816302 15:52458502-52458524 CCCCGCCACTAGAGAGGCTGAGG + Intronic
1129731610 15:77935639-77935661 CCTCCCCATCAGAGAGGCTGTGG + Intergenic
1137600096 16:49750543-49750565 CCTCTCCAGAAGAGAGGCGCAGG + Intronic
1140697976 16:77553700-77553722 GCACCCCATAAGAGATGCTTTGG + Intergenic
1146540310 17:33687771-33687793 CCAGGTCATTAGAGAGGCTTGGG - Intronic
1150479542 17:65498857-65498879 CCTCGCCTGGAGAGAGGCTCTGG - Intergenic
1150816308 17:68394953-68394975 CCAGCCCATAGGAGAGGCTGTGG + Intronic
1151313772 17:73310098-73310120 CCAGGCCCTAAGAGAGCCCCTGG - Intronic
1151567430 17:74907132-74907154 CCACGGCAGAGGGGAGGCTCAGG + Intergenic
1151763908 17:76122383-76122405 CCAGGCCACAGGAGAGGCACAGG + Intergenic
926055976 2:9774288-9774310 TCAACCCATAAGAGAGGCTCAGG + Intergenic
929578558 2:43067901-43067923 CCCCGCCATGGGAGAGGCCCAGG + Intergenic
934577782 2:95413897-95413919 CCACCCCAATAGAGTGGCTCAGG - Exonic
934793581 2:97082799-97082821 CCACCCCAATAGAGTGGCTCAGG + Intergenic
942170223 2:173282679-173282701 CCACGGCAGCAGGGAGGCTCAGG + Intergenic
942888032 2:180952503-180952525 CCAAGCTGTAAGACAGGCTCTGG + Intergenic
948624341 2:239259802-239259824 TCACGCCATACCACAGGCTCTGG - Intronic
1174784255 20:53418039-53418061 TGACGCCATAAGAGTGGCTGTGG + Intronic
1175988869 20:62777746-62777768 CCATGCCATCAGATAGGCTGGGG - Intergenic
1175988881 20:62777798-62777820 CCACGCCATCAGACATGCTGGGG - Intergenic
1175988886 20:62777822-62777844 CCACGCCATCAGGCAGGCTGGGG - Intergenic
1175988893 20:62777846-62777868 CCATGCCATCAGACAGGCTGGGG - Intergenic
1175988900 20:62777870-62777892 CCACGCCATCAGACAGGCCGGGG - Intergenic
1175988906 20:62777894-62777916 CCACGCCATCAGACAGACTGGGG - Intergenic
1175988912 20:62777918-62777940 CCACGCCATCAGACAGGCCGGGG - Intergenic
1175988931 20:62777990-62778012 CCACACCATCAGACAGGCTGGGG - Intergenic
1175988955 20:62778086-62778108 CCACGCCATCAGACAGGCTGGGG - Intergenic
1175988985 20:62778210-62778232 CGACGCCATCAGACAGGCTGGGG - Intergenic
1175989002 20:62778282-62778304 CCATGCCATCAGACAGGCTGGGG - Intergenic
1175989008 20:62778306-62778328 CCACACCATCAGATAGGCTGAGG - Intergenic
1175989028 20:62778392-62778414 CCACCCCATCAGACAGGCTGGGG - Intergenic
1181562685 22:23714911-23714933 CCACCCCAGAAGACAGGCTATGG + Intergenic
1182477007 22:30581842-30581864 CCCAGCCACAAGTGAGGCTCTGG + Intronic
1184119643 22:42441454-42441476 CCTCGCCATGAGGGAGGCCCAGG - Intergenic
949933937 3:9102029-9102051 CCAAGCCAGAAGATAGGCACAGG + Intronic
954089982 3:48276612-48276634 CCCCGCCATAAGCAAGGCACGGG - Intronic
954243890 3:49315781-49315803 CCAGGCCCAAAGTGAGGCTCTGG + Intronic
963440159 3:145330904-145330926 CCCAGCCATAGGAGAGGCTGAGG - Intergenic
963509356 3:146227653-146227675 CCTCTCCACAAGGGAGGCTCTGG + Intronic
964596200 3:158432385-158432407 CCAGGACATAAGAGAGTCTATGG + Intronic
973120144 4:46511668-46511690 CCACACCATAAGACAGTGTCAGG + Intergenic
977416693 4:96742789-96742811 CCATGGCGTAAGGGAGGCTCAGG - Intergenic
981871748 4:149495198-149495220 CCATGCCATAAGAGAGTCCCTGG - Intergenic
982317968 4:154050453-154050475 CCACGCCATAGGAGAGCCAGAGG - Intergenic
989967272 5:50479086-50479108 CCAAGCCAGAAGAGAGGCAGAGG + Intergenic
995825792 5:116297561-116297583 CCATGTTATAAGAGAGGCTGCGG + Intronic
1001648108 5:173297190-173297212 CCACTGCCCAAGAGAGGCTCGGG - Intergenic
1007576600 6:42929241-42929263 CCACCCCCTAACGGAGGCTCTGG - Exonic
1018855238 6:167670036-167670058 CCACGCCATAAGAGAGGCTCAGG + Intergenic
1022157073 7:27671379-27671401 CTAAGACATAAGAGATGCTCAGG + Intergenic
1025227541 7:57178103-57178125 CCACGCCAGAAGACAGGCTGTGG + Intergenic
1032784370 7:135188752-135188774 CCAGGTCAGAAGTGAGGCTCAGG + Intronic
1034048338 7:147953808-147953830 CCACGTGACAAGAGAGGCTGAGG - Intronic
1040561837 8:48529363-48529385 GCACGCCATAGGAGGGGCACAGG - Intergenic
1047876144 8:129139860-129139882 CCAAGCCATAGCAGTGGCTCTGG - Intergenic
1050124240 9:2339922-2339944 CCTCGCCACAAGAGTGGCTTAGG - Intergenic
1061432099 9:130537459-130537481 GGACTCCATCAGAGAGGCTCAGG + Intergenic
1192093558 X:68186289-68186311 GCAGGACATAAGAGATGCTCAGG + Intronic
1197978785 X:132194356-132194378 CCACGGCATGGGGGAGGCTCAGG - Intergenic
1199323059 X:146463616-146463638 CCACTCCATCAGAGAGGCAGAGG - Intergenic