ID: 1018855317

View in Genome Browser
Species Human (GRCh38)
Location 6:167670402-167670424
Sequence GGGGGAGGTCCCTCCAGGGA GGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total 333
Summary {0: 1, 1: 0, 2: 4, 3: 31, 4: 297}

Found 5 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1018855317_1018855333 30 Left 1018855317 6:167670402-167670424 CCCTCCCTGGAGGGACCTCCCCC 0: 1
1: 0
2: 4
3: 31
4: 297
Right 1018855333 6:167670455-167670477 GTCTCAGCCTGCATTCCCCAGGG 0: 1
1: 0
2: 1
3: 29
4: 211
1018855317_1018855327 5 Left 1018855317 6:167670402-167670424 CCCTCCCTGGAGGGACCTCCCCC 0: 1
1: 0
2: 4
3: 31
4: 297
Right 1018855327 6:167670430-167670452 AAACCCTGCTCCAGAAGCATGGG 0: 1
1: 0
2: 1
3: 12
4: 238
1018855317_1018855329 8 Left 1018855317 6:167670402-167670424 CCCTCCCTGGAGGGACCTCCCCC 0: 1
1: 0
2: 4
3: 31
4: 297
Right 1018855329 6:167670433-167670455 CCCTGCTCCAGAAGCATGGGTGG 0: 1
1: 0
2: 2
3: 22
4: 243
1018855317_1018855332 29 Left 1018855317 6:167670402-167670424 CCCTCCCTGGAGGGACCTCCCCC 0: 1
1: 0
2: 4
3: 31
4: 297
Right 1018855332 6:167670454-167670476 GGTCTCAGCCTGCATTCCCCAGG 0: 1
1: 0
2: 0
3: 17
4: 212
1018855317_1018855326 4 Left 1018855317 6:167670402-167670424 CCCTCCCTGGAGGGACCTCCCCC 0: 1
1: 0
2: 4
3: 31
4: 297
Right 1018855326 6:167670429-167670451 GAAACCCTGCTCCAGAAGCATGG 0: 1
1: 0
2: 6
3: 13
4: 230

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1018855317 Original CRISPR GGGGGAGGTCCCTCCAGGGA GGG (reversed) Intergenic