ID: 1018855319

View in Genome Browser
Species Human (GRCh38)
Location 6:167670406-167670428
Strand -
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total 157
Summary {0: 1, 1: 0, 2: 0, 3: 12, 4: 144}

Found 5 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1018855319_1018855329 4 Left 1018855319 6:167670406-167670428 CCCTGGAGGGACCTCCCCCACAT 0: 1
1: 0
2: 0
3: 12
4: 144
Right 1018855329 6:167670433-167670455 CCCTGCTCCAGAAGCATGGGTGG 0: 1
1: 0
2: 2
3: 22
4: 243
1018855319_1018855326 0 Left 1018855319 6:167670406-167670428 CCCTGGAGGGACCTCCCCCACAT 0: 1
1: 0
2: 0
3: 12
4: 144
Right 1018855326 6:167670429-167670451 GAAACCCTGCTCCAGAAGCATGG 0: 1
1: 0
2: 6
3: 13
4: 230
1018855319_1018855333 26 Left 1018855319 6:167670406-167670428 CCCTGGAGGGACCTCCCCCACAT 0: 1
1: 0
2: 0
3: 12
4: 144
Right 1018855333 6:167670455-167670477 GTCTCAGCCTGCATTCCCCAGGG 0: 1
1: 0
2: 1
3: 29
4: 211
1018855319_1018855327 1 Left 1018855319 6:167670406-167670428 CCCTGGAGGGACCTCCCCCACAT 0: 1
1: 0
2: 0
3: 12
4: 144
Right 1018855327 6:167670430-167670452 AAACCCTGCTCCAGAAGCATGGG 0: 1
1: 0
2: 1
3: 12
4: 238
1018855319_1018855332 25 Left 1018855319 6:167670406-167670428 CCCTGGAGGGACCTCCCCCACAT 0: 1
1: 0
2: 0
3: 12
4: 144
Right 1018855332 6:167670454-167670476 GGTCTCAGCCTGCATTCCCCAGG 0: 1
1: 0
2: 0
3: 17
4: 212

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1018855319 Original CRISPR ATGTGGGGGAGGTCCCTCCA GGG (reversed) Intergenic