ID: 1018855321

View in Genome Browser
Species Human (GRCh38)
Location 6:167670417-167670439
Strand -
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total 243
Summary {0: 1, 1: 0, 2: 0, 3: 18, 4: 224}

Found 5 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1018855321_1018855332 14 Left 1018855321 6:167670417-167670439 CCTCCCCCACATGAAACCCTGCT 0: 1
1: 0
2: 0
3: 18
4: 224
Right 1018855332 6:167670454-167670476 GGTCTCAGCCTGCATTCCCCAGG 0: 1
1: 0
2: 0
3: 17
4: 212
1018855321_1018855333 15 Left 1018855321 6:167670417-167670439 CCTCCCCCACATGAAACCCTGCT 0: 1
1: 0
2: 0
3: 18
4: 224
Right 1018855333 6:167670455-167670477 GTCTCAGCCTGCATTCCCCAGGG 0: 1
1: 0
2: 1
3: 29
4: 211
1018855321_1018855329 -7 Left 1018855321 6:167670417-167670439 CCTCCCCCACATGAAACCCTGCT 0: 1
1: 0
2: 0
3: 18
4: 224
Right 1018855329 6:167670433-167670455 CCCTGCTCCAGAAGCATGGGTGG 0: 1
1: 0
2: 2
3: 22
4: 243
1018855321_1018855327 -10 Left 1018855321 6:167670417-167670439 CCTCCCCCACATGAAACCCTGCT 0: 1
1: 0
2: 0
3: 18
4: 224
Right 1018855327 6:167670430-167670452 AAACCCTGCTCCAGAAGCATGGG 0: 1
1: 0
2: 1
3: 12
4: 238
1018855321_1018855335 24 Left 1018855321 6:167670417-167670439 CCTCCCCCACATGAAACCCTGCT 0: 1
1: 0
2: 0
3: 18
4: 224
Right 1018855335 6:167670464-167670486 TGCATTCCCCAGGGAGAATGAGG 0: 1
1: 0
2: 1
3: 23
4: 252

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1018855321 Original CRISPR AGCAGGGTTTCATGTGGGGG AGG (reversed) Intergenic