ID: 1018855322

View in Genome Browser
Species Human (GRCh38)
Location 6:167670420-167670442
Sequence TGGAGCAGGGTTTCATGTGG GGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total 229
Summary {0: 1, 1: 0, 2: 1, 3: 19, 4: 208}

Found 4 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1018855322_1018855332 11 Left 1018855322 6:167670420-167670442 CCCCCACATGAAACCCTGCTCCA 0: 1
1: 0
2: 1
3: 19
4: 208
Right 1018855332 6:167670454-167670476 GGTCTCAGCCTGCATTCCCCAGG 0: 1
1: 0
2: 0
3: 17
4: 212
1018855322_1018855335 21 Left 1018855322 6:167670420-167670442 CCCCCACATGAAACCCTGCTCCA 0: 1
1: 0
2: 1
3: 19
4: 208
Right 1018855335 6:167670464-167670486 TGCATTCCCCAGGGAGAATGAGG 0: 1
1: 0
2: 1
3: 23
4: 252
1018855322_1018855333 12 Left 1018855322 6:167670420-167670442 CCCCCACATGAAACCCTGCTCCA 0: 1
1: 0
2: 1
3: 19
4: 208
Right 1018855333 6:167670455-167670477 GTCTCAGCCTGCATTCCCCAGGG 0: 1
1: 0
2: 1
3: 29
4: 211
1018855322_1018855329 -10 Left 1018855322 6:167670420-167670442 CCCCCACATGAAACCCTGCTCCA 0: 1
1: 0
2: 1
3: 19
4: 208
Right 1018855329 6:167670433-167670455 CCCTGCTCCAGAAGCATGGGTGG 0: 1
1: 0
2: 2
3: 22
4: 243

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1018855322 Original CRISPR TGGAGCAGGGTTTCATGTGG GGG (reversed) Intergenic