ID: 1018855324

View in Genome Browser
Species Human (GRCh38)
Location 6:167670422-167670444
Sequence TCTGGAGCAGGGTTTCATGT GGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total 179
Summary {0: 1, 1: 0, 2: 1, 3: 12, 4: 165}

Found 3 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1018855324_1018855333 10 Left 1018855324 6:167670422-167670444 CCCACATGAAACCCTGCTCCAGA 0: 1
1: 0
2: 1
3: 12
4: 165
Right 1018855333 6:167670455-167670477 GTCTCAGCCTGCATTCCCCAGGG 0: 1
1: 0
2: 1
3: 29
4: 211
1018855324_1018855332 9 Left 1018855324 6:167670422-167670444 CCCACATGAAACCCTGCTCCAGA 0: 1
1: 0
2: 1
3: 12
4: 165
Right 1018855332 6:167670454-167670476 GGTCTCAGCCTGCATTCCCCAGG 0: 1
1: 0
2: 0
3: 17
4: 212
1018855324_1018855335 19 Left 1018855324 6:167670422-167670444 CCCACATGAAACCCTGCTCCAGA 0: 1
1: 0
2: 1
3: 12
4: 165
Right 1018855335 6:167670464-167670486 TGCATTCCCCAGGGAGAATGAGG 0: 1
1: 0
2: 1
3: 23
4: 252

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1018855324 Original CRISPR TCTGGAGCAGGGTTTCATGT GGG (reversed) Intergenic